Mutagenetix > Incidental Mutations

Incidental Mutation 'R5157:Plekhg5'

396773

Institutional Source

Beutler Lab

Gene Symbol

Plekhg5

Ensembl Gene

ENSMUSG00000039713

Gene Name

pleckstrin homology domain containing, family G (with RhoGef domain) member 5

Synonyms

MMRRC Submission

042739-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R5157 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

152072498-152115400 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 152107865 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084115] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]

Predicted Effect

probably benign
Transcript: ENSMUST00000084115

SMART Domains

Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713

Domain	Start	End	E-Value	Type
low complexity region	314	334	N/A	INTRINSIC
low complexity region	369	380	N/A	INTRINSIC
RhoGEF	410	597	5.21e-53	SMART
PH	655	756	7.35e-12	SMART
low complexity region	778	790	N/A	INTRINSIC
low complexity region	895	934	N/A	INTRINSIC
low complexity region	1060	1069	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105661

SMART Domains

Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713

Domain	Start	End	E-Value	Type
low complexity region	314	334	N/A	INTRINSIC
low complexity region	369	380	N/A	INTRINSIC
RhoGEF	410	597	5.21e-53	SMART
PH	655	756	7.35e-12	SMART
low complexity region	778	790	N/A	INTRINSIC
low complexity region	895	934	N/A	INTRINSIC
low complexity region	1060	1069	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105662

SMART Domains

Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713

Domain	Start	End	E-Value	Type
low complexity region	282	302	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
RhoGEF	378	565	5.21e-53	SMART
PH	623	724	7.35e-12	SMART
low complexity region	746	758	N/A	INTRINSIC
low complexity region	863	902	N/A	INTRINSIC
low complexity region	1028	1037	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118648

SMART Domains

Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713

Domain	Start	End	E-Value	Type
low complexity region	301	321	N/A	INTRINSIC
low complexity region	356	367	N/A	INTRINSIC
RhoGEF	397	584	5.21e-53	SMART
PH	642	743	7.35e-12	SMART
low complexity region	765	777	N/A	INTRINSIC
low complexity region	882	921	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123615

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142412

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: This gene encodes a protein belonging to the Rho guanine exchange factor (GEF) family of proteins, which activate GTPases by replacing GDP with GTP. This family member is a RhoA GEF that plays a role in endothelial cell migration and tube formation. It is required for angiogenesis and may function in neuronal cell differentiation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display angiogenic defects that affect multiple organs, including sparser coronary and kidney arterial systems that appear to deficient in small diameter vessels while the major coronary and kidney arteries remain intact. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,686,066	S2T	probably benign	Het
Abca3	C	T	17: 24,408,122	R1266C	probably damaging	Het
Adap2	T	C	11: 80,156,946	F76S	probably damaging	Het
Adgb	T	A	10: 10,398,966	H747L	probably damaging	Het
Aox1	T	A	1: 58,070,063	V670D	probably damaging	Het
Ap4e1	A	G	2: 127,061,695	D839G	probably benign	Het
Arhgef11	T	A	3: 87,728,510		probably null	Het
AY074887	T	C	9: 54,950,818		probably benign	Het
Bicd1	C	G	6: 149,520,414	Q878E	probably benign	Het
Catspere1	A	T	1: 177,879,782		noncoding transcript	Het
Cnmd	T	C	14: 79,656,686	Q87R	probably benign	Het
Col24a1	G	T	3: 145,345,951	G661*	probably null	Het
Crtap	G	A	9: 114,384,792	L232F	probably damaging	Het
Ctsq	T	C	13: 61,037,099	T258A	probably benign	Het
Cyp2d26	T	C	15: 82,790,989	Q388R	probably benign	Het
Ddb1	A	T	19: 10,622,364	T646S	probably benign	Het
Dnah6	G	T	6: 73,195,634	S280R	probably benign	Het
Dzank1	T	C	2: 144,483,412	H545R	probably damaging	Het
Ehhadh	T	A	16: 21,766,511	M207L	probably benign	Het
Elmo2	T	A	2: 165,291,707		probably benign	Het
Golga3	G	A	5: 110,202,671	A731T	probably benign	Het
Igsf21	T	C	4: 140,028,067	T426A	possibly damaging	Het
Kcnf1	T	C	12: 17,174,741	E493G	probably benign	Het
Lmna	A	T	3: 88,484,107	D364E	probably damaging	Het
Lsr	T	C	7: 30,966,040	Y163C	probably damaging	Het
Map3k20	A	T	2: 72,438,214	T522S	probably benign	Het
Mpp5	T	A	12: 78,820,815	M324K	possibly damaging	Het
Mroh9	C	A	1: 163,044,121	A598S	probably damaging	Het
Msln	T	C	17: 25,752,983	M87V	probably benign	Het
Olfr1155	T	A	2: 87,942,888	M247L	probably benign	Het
Olfr1197	T	A	2: 88,729,548	Q17L	probably benign	Het
Olfr292	A	G	7: 86,695,232	K259E	probably benign	Het
Olfr385	T	C	11: 73,589,723	N5S	probably damaging	Het
Pprc1	G	T	19: 46,064,758		probably benign	Het
Ptprm	T	A	17: 66,957,097	K385I	probably benign	Het
Rfxap	T	A	3: 54,804,517	N215I	probably damaging	Het
Slc16a7	A	T	10: 125,233,464	Y114*	probably null	Het
Smarcb1	G	T	10: 75,911,794		probably benign	Het
Spef2	T	A	15: 9,668,791	R770*	probably null	Het
Stard9	A	T	2: 120,697,861	Y1533F	probably benign	Het
Tbcd	A	T	11: 121,610,027	Y1142F	probably benign	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Uba7	G	A	9: 107,980,047	V703I	probably benign	Het
Upb1	T	C	10: 75,412,804	S53P	possibly damaging	Het
Zfp672	A	G	11: 58,316,851	S215P	possibly damaging	Het
Zfp978	T	A	4: 147,390,980	L328H	probably damaging	Het

Other mutations in Plekhg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Plekhg5	APN	4	152102041	splice site	probably null
IGL01025:Plekhg5	APN	4	152108526	missense	probably damaging	1.00
IGL01062:Plekhg5	APN	4	152108496	missense	probably damaging	1.00
IGL01138:Plekhg5	APN	4	152106978	missense	probably damaging	1.00
IGL01301:Plekhg5	APN	4	152112553	missense	probably benign
IGL02372:Plekhg5	APN	4	152102080	missense	probably damaging	0.96
IGL02701:Plekhg5	APN	4	152103022	missense	probably damaging	1.00
ANU18:Plekhg5	UTSW	4	152112553	missense	probably benign
R0005:Plekhg5	UTSW	4	152112651	small deletion	probably benign
R0012:Plekhg5	UTSW	4	152104750	missense	probably benign	0.20
R0050:Plekhg5	UTSW	4	152108088	critical splice donor site	probably null
R0233:Plekhg5	UTSW	4	152112219	missense	probably damaging	1.00
R0233:Plekhg5	UTSW	4	152112219	missense	probably damaging	1.00
R0234:Plekhg5	UTSW	4	152112219	missense	probably damaging	1.00
R0346:Plekhg5	UTSW	4	152114253	missense	probably benign	0.08
R0555:Plekhg5	UTSW	4	152107469	nonsense	probably null
R0631:Plekhg5	UTSW	4	152112419	missense	possibly damaging	0.89
R0639:Plekhg5	UTSW	4	152114120	missense	probably benign	0.19
R1372:Plekhg5	UTSW	4	152104731	missense	probably damaging	0.99
R1563:Plekhg5	UTSW	4	152096809	missense	probably benign	0.33
R2870:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2870:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2871:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2871:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2872:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2872:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2873:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R3104:Plekhg5	UTSW	4	152112178	missense	probably damaging	1.00
R3106:Plekhg5	UTSW	4	152112178	missense	probably damaging	1.00
R3408:Plekhg5	UTSW	4	152108292	missense	probably damaging	1.00
R4289:Plekhg5	UTSW	4	152112427	missense	probably benign	0.05
R5643:Plekhg5	UTSW	4	152104340	missense	probably benign	0.14
R5644:Plekhg5	UTSW	4	152104340	missense	probably benign	0.14
R5790:Plekhg5	UTSW	4	152113935	missense	probably benign
R6770:Plekhg5	UTSW	4	152103079	missense	probably benign
R7027:Plekhg5	UTSW	4	152113974	missense	probably benign	0.01
R7039:Plekhg5	UTSW	4	152107785	missense	possibly damaging	0.90
R7092:Plekhg5	UTSW	4	152114508	missense	probably damaging	1.00
R7309:Plekhg5	UTSW	4	152112528	missense	possibly damaging	0.50
R7319:Plekhg5	UTSW	4	152108428	missense	probably benign	0.13
R7439:Plekhg5	UTSW	4	152113935	missense	probably benign	0.19
R7543:Plekhg5	UTSW	4	152108034	missense	probably damaging	1.00
R7662:Plekhg5	UTSW	4	152104298	missense	probably damaging	1.00
R8271:Plekhg5	UTSW	4	152103007	missense	probably damaging	1.00
R8322:Plekhg5	UTSW	4	152104744	missense	possibly damaging	0.77
R9024:Plekhg5	UTSW	4	152112661	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- GCTTGAGCGGGGCTAAATAG -3'
(R):5'- AACAGATCGTTGTCACGCAGC -3'

Sequencing Primer
(F):5'- GGAGCCAACCCACACTTGTG -3'
(R):5'- AGGCCGCGCATGTACTC -3'

Posted On

2016-06-21