Mutagenetix > Incidental Mutations

Incidental Mutation 'R5157:Adgb'

396785

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

042739-MU

Accession Numbers

MGI:3605549

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5157 (G1)

Quality Score

184

Status

Validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10398966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 747 (H747L)

Ref Sequence

ENSEMBL: ENSMUSP00000134378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably benign
Transcript: ENSMUST00000045328

SMART Domains

Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	11	257	1e-165	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000132573

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148816

SMART Domains

Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	1	41	1e-19	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000172530
AA Change: H747L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: H747L

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000179956
AA Change: H749L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: H749L

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208717
AA Change: H723L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.4376

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,686,066	S2T	probably benign	Het
Abca3	C	T	17: 24,408,122	R1266C	probably damaging	Het
Adap2	T	C	11: 80,156,946	F76S	probably damaging	Het
Aox1	T	A	1: 58,070,063	V670D	probably damaging	Het
Ap4e1	A	G	2: 127,061,695	D839G	probably benign	Het
Arhgef11	T	A	3: 87,728,510		probably null	Het
AY074887	T	C	9: 54,950,818		probably benign	Het
Bicd1	C	G	6: 149,520,414	Q878E	probably benign	Het
Catspere1	A	T	1: 177,879,782		noncoding transcript	Het
Cnmd	T	C	14: 79,656,686	Q87R	probably benign	Het
Col24a1	G	T	3: 145,345,951	G661*	probably null	Het
Crtap	G	A	9: 114,384,792	L232F	probably damaging	Het
Ctsq	T	C	13: 61,037,099	T258A	probably benign	Het
Cyp2d26	T	C	15: 82,790,989	Q388R	probably benign	Het
Ddb1	A	T	19: 10,622,364	T646S	probably benign	Het
Dnah6	G	T	6: 73,195,634	S280R	probably benign	Het
Dzank1	T	C	2: 144,483,412	H545R	probably damaging	Het
Ehhadh	T	A	16: 21,766,511	M207L	probably benign	Het
Elmo2	T	A	2: 165,291,707		probably benign	Het
Golga3	G	A	5: 110,202,671	A731T	probably benign	Het
Igsf21	T	C	4: 140,028,067	T426A	possibly damaging	Het
Kcnf1	T	C	12: 17,174,741	E493G	probably benign	Het
Lmna	A	T	3: 88,484,107	D364E	probably damaging	Het
Lsr	T	C	7: 30,966,040	Y163C	probably damaging	Het
Map3k20	A	T	2: 72,438,214	T522S	probably benign	Het
Mpp5	T	A	12: 78,820,815	M324K	possibly damaging	Het
Mroh9	C	A	1: 163,044,121	A598S	probably damaging	Het
Msln	T	C	17: 25,752,983	M87V	probably benign	Het
Olfr1155	T	A	2: 87,942,888	M247L	probably benign	Het
Olfr1197	T	A	2: 88,729,548	Q17L	probably benign	Het
Olfr292	A	G	7: 86,695,232	K259E	probably benign	Het
Olfr385	T	C	11: 73,589,723	N5S	probably damaging	Het
Plekhg5	T	A	4: 152,107,865		probably benign	Het
Pprc1	G	T	19: 46,064,758		probably benign	Het
Ptprm	T	A	17: 66,957,097	K385I	probably benign	Het
Rfxap	T	A	3: 54,804,517	N215I	probably damaging	Het
Slc16a7	A	T	10: 125,233,464	Y114*	probably null	Het
Smarcb1	G	T	10: 75,911,794		probably benign	Het
Spef2	T	A	15: 9,668,791	R770*	probably null	Het
Stard9	A	T	2: 120,697,861	Y1533F	probably benign	Het
Tbcd	A	T	11: 121,610,027	Y1142F	probably benign	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Uba7	G	A	9: 107,980,047	V703I	probably benign	Het
Upb1	T	C	10: 75,412,804	S53P	possibly damaging	Het
Zfp672	A	G	11: 58,316,851	S215P	possibly damaging	Het
Zfp978	T	A	4: 147,390,980	L328H	probably damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GGTTCTCAGAGATCACACCTC -3'
(R):5'- GTGCAAATCTAGGTAGTTATCCCTTC -3'

Sequencing Primer
(F):5'- GATCACACCTCACCATTTATTAGAGG -3'
(R):5'- CTGATCAGGCAACTAGCA -3'

Posted On

2016-06-21