Incidental Mutation 'R5157:Smarcb1'
ID 396787
Institutional Source Beutler Lab
Gene Symbol Smarcb1
Ensembl Gene ENSMUSG00000000902
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
Synonyms Snf5, SNF5/INI1, integrase interactor 1, Ini1, Baf47
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5157 (G1)
Quality Score 200
Status Validated
Chromosome 10
Chromosomal Location 75896769-75921617 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to T at 75911794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000925] [ENSMUST00000121304] [ENSMUST00000140388] [ENSMUST00000146555]
AlphaFold Q9Z0H3
Predicted Effect probably benign
Transcript: ENSMUST00000000925
SMART Domains Protein: ENSMUSP00000000925
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 179 254 1.1e-27 PFAM
Pfam:SNF5 249 373 3.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121304
SMART Domains Protein: ENSMUSP00000112463
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 169 364 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133189
Predicted Effect probably benign
Transcript: ENSMUST00000140388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140408
Predicted Effect unknown
Transcript: ENSMUST00000146555
AA Change: T45K
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that relieves repressive chromatin structures, allowing the transcriptional machinery to access its targets more effectively. The encoded nuclear protein may also bind to and enhance the DNA joining activity of HIV-1 integrase. This gene has been found to be a tumor suppressor, and mutations in it have been associated with malignant rhabdoid tumors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to peri-implantation lethality, likely due to an inability of the blastocysts to hatch and implant in the uterus. A subset of heterozygous null mice develop a variety of tumors in the soft tissues of the head and neck. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Smarcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Smarcb1 APN 10 75916768 splice site probably null
IGL02399:Smarcb1 APN 10 75897494 missense probably damaging 1.00
IGL02457:Smarcb1 APN 10 75921371 missense probably benign 0.01
R0505:Smarcb1 UTSW 10 75897066 missense probably damaging 1.00
R1120:Smarcb1 UTSW 10 75921323 missense probably benign
R2846:Smarcb1 UTSW 10 75897541 missense probably damaging 1.00
R3725:Smarcb1 UTSW 10 75916786 missense probably benign 0.00
R5089:Smarcb1 UTSW 10 75915179 missense probably benign 0.00
R5632:Smarcb1 UTSW 10 75904418 nonsense probably null
R5662:Smarcb1 UTSW 10 75904570 missense possibly damaging 0.95
R7472:Smarcb1 UTSW 10 75897539 missense probably damaging 1.00
R8112:Smarcb1 UTSW 10 75910152 critical splice donor site probably null
R9151:Smarcb1 UTSW 10 75915082 missense probably benign 0.01
Z1176:Smarcb1 UTSW 10 75906077 missense probably benign 0.00
Z1177:Smarcb1 UTSW 10 75904511 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCCACTGGCTGTTCCTC -3'
(R):5'- TGCAGTGTGGGAATAGAACG -3'

Sequencing Primer
(F):5'- ACTGGCTGTTCCTCTTGGC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2016-06-21