Mutagenetix > Incidental Mutations

Incidental Mutation 'R5157:Slc16a7'

396788

Institutional Source

Beutler Lab

Gene Symbol

Slc16a7

Ensembl Gene

ENSMUSG00000020102

Gene Name

solute carrier family 16 (monocarboxylic acid transporters), member 7

Synonyms

4921534N07Rik, MCT2

MMRRC Submission

042739-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R5157 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125219270-125389465 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 125233464 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 114 (Y114*)

Ref Sequence

ENSEMBL: ENSMUSP00000147968 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]

AlphaFold

O70451

Predicted Effect

probably null
Transcript: ENSMUST00000063318
AA Change: Y114*

SMART Domains

Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: Y114*

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:MFS_1	22	389	2e-37	PFAM
transmembrane domain	404	426	N/A	INTRINSIC
coiled coil region	436	463	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105257
AA Change: Y114*

SMART Domains

Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: Y114*

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:MFS_1	22	389	6e-37	PFAM
transmembrane domain	404	426	N/A	INTRINSIC
coiled coil region	436	463	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000210780
AA Change: Y114*

Predicted Effect

probably null
Transcript: ENSMUST00000211781
AA Change: Y114*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,686,066	S2T	probably benign	Het
Abca3	C	T	17: 24,408,122	R1266C	probably damaging	Het
Adap2	T	C	11: 80,156,946	F76S	probably damaging	Het
Adgb	T	A	10: 10,398,966	H747L	probably damaging	Het
Aox1	T	A	1: 58,070,063	V670D	probably damaging	Het
Ap4e1	A	G	2: 127,061,695	D839G	probably benign	Het
Arhgef11	T	A	3: 87,728,510		probably null	Het
AY074887	T	C	9: 54,950,818		probably benign	Het
Bicd1	C	G	6: 149,520,414	Q878E	probably benign	Het
Catspere1	A	T	1: 177,879,782		noncoding transcript	Het
Cnmd	T	C	14: 79,656,686	Q87R	probably benign	Het
Col24a1	G	T	3: 145,345,951	G661*	probably null	Het
Crtap	G	A	9: 114,384,792	L232F	probably damaging	Het
Ctsq	T	C	13: 61,037,099	T258A	probably benign	Het
Cyp2d26	T	C	15: 82,790,989	Q388R	probably benign	Het
Ddb1	A	T	19: 10,622,364	T646S	probably benign	Het
Dnah6	G	T	6: 73,195,634	S280R	probably benign	Het
Dzank1	T	C	2: 144,483,412	H545R	probably damaging	Het
Ehhadh	T	A	16: 21,766,511	M207L	probably benign	Het
Elmo2	T	A	2: 165,291,707		probably benign	Het
Golga3	G	A	5: 110,202,671	A731T	probably benign	Het
Igsf21	T	C	4: 140,028,067	T426A	possibly damaging	Het
Kcnf1	T	C	12: 17,174,741	E493G	probably benign	Het
Lmna	A	T	3: 88,484,107	D364E	probably damaging	Het
Lsr	T	C	7: 30,966,040	Y163C	probably damaging	Het
Map3k20	A	T	2: 72,438,214	T522S	probably benign	Het
Mpp5	T	A	12: 78,820,815	M324K	possibly damaging	Het
Mroh9	C	A	1: 163,044,121	A598S	probably damaging	Het
Msln	T	C	17: 25,752,983	M87V	probably benign	Het
Olfr1155	T	A	2: 87,942,888	M247L	probably benign	Het
Olfr1197	T	A	2: 88,729,548	Q17L	probably benign	Het
Olfr292	A	G	7: 86,695,232	K259E	probably benign	Het
Olfr385	T	C	11: 73,589,723	N5S	probably damaging	Het
Plekhg5	T	A	4: 152,107,865		probably benign	Het
Pprc1	G	T	19: 46,064,758		probably benign	Het
Ptprm	T	A	17: 66,957,097	K385I	probably benign	Het
Rfxap	T	A	3: 54,804,517	N215I	probably damaging	Het
Smarcb1	G	T	10: 75,911,794		probably benign	Het
Spef2	T	A	15: 9,668,791	R770*	probably null	Het
Stard9	A	T	2: 120,697,861	Y1533F	probably benign	Het
Tbcd	A	T	11: 121,610,027	Y1142F	probably benign	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Uba7	G	A	9: 107,980,047	V703I	probably benign	Het
Upb1	T	C	10: 75,412,804	S53P	possibly damaging	Het
Zfp672	A	G	11: 58,316,851	S215P	possibly damaging	Het
Zfp978	T	A	4: 147,390,980	L328H	probably damaging	Het

Other mutations in Slc16a7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00857:Slc16a7	APN	10	125230934	missense	probably benign	0.16
IGL02228:Slc16a7	APN	10	125230798	missense	probably damaging	1.00
IGL02500:Slc16a7	APN	10	125230933	missense	probably damaging	1.00
IGL03277:Slc16a7	APN	10	125230691	missense	probably benign	0.00
R0044:Slc16a7	UTSW	10	125228082	missense	probably benign	0.01
R0076:Slc16a7	UTSW	10	125228070	missense	probably benign	0.34
R0285:Slc16a7	UTSW	10	125294631	missense	probably benign	0.22
R0546:Slc16a7	UTSW	10	125230873	missense	probably benign	0.02
R0898:Slc16a7	UTSW	10	125233501	missense	possibly damaging	0.46
R1123:Slc16a7	UTSW	10	125231147	missense	probably benign	0.00
R1173:Slc16a7	UTSW	10	125231372	missense	possibly damaging	0.82
R1459:Slc16a7	UTSW	10	125230620	nonsense	probably null
R1554:Slc16a7	UTSW	10	125230922	missense	possibly damaging	0.70
R1838:Slc16a7	UTSW	10	125231198	missense	probably damaging	1.00
R3545:Slc16a7	UTSW	10	125294700	nonsense	probably null
R3546:Slc16a7	UTSW	10	125294700	nonsense	probably null
R3547:Slc16a7	UTSW	10	125294700	nonsense	probably null
R3934:Slc16a7	UTSW	10	125230843	missense	probably damaging	1.00
R3935:Slc16a7	UTSW	10	125230843	missense	probably damaging	1.00
R4499:Slc16a7	UTSW	10	125228187	missense	probably damaging	1.00
R4512:Slc16a7	UTSW	10	125233439	splice site	probably null
R4513:Slc16a7	UTSW	10	125233439	splice site	probably null
R4514:Slc16a7	UTSW	10	125233439	splice site	probably null
R5247:Slc16a7	UTSW	10	125231314	missense	probably damaging	1.00
R5385:Slc16a7	UTSW	10	125294604	missense	possibly damaging	0.85
R6198:Slc16a7	UTSW	10	125228215	missense	probably benign
R6263:Slc16a7	UTSW	10	125294639	missense	probably benign	0.16
R6430:Slc16a7	UTSW	10	125231018	missense	probably damaging	0.97
R7450:Slc16a7	UTSW	10	125228051	missense	probably benign	0.00
R7680:Slc16a7	UTSW	10	125230936	missense	probably benign	0.19
R8125:Slc16a7	UTSW	10	125328333	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTGCAGGATGACACATGC -3'
(R):5'- GTGCACTGATCTCTTTTGATCACTG -3'

Sequencing Primer
(F):5'- TGACACATGCAAAACTGTATGG -3'
(R):5'- CCTCTCAGAACAAAGAAGTATTAAGG -3'

Posted On

2016-06-21