Incidental Mutation 'R5157:Ctsq'
ID396796
Institutional Source Beutler Lab
Gene Symbol Ctsq
Ensembl Gene ENSMUSG00000021439
Gene Namecathepsin Q
Synonyms1600010J02Rik
MMRRC Submission 042739-MU
Accession Numbers

Ncbi RefSeq: NM_029636.3; MGI:2137385

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location61035024-61040631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61037099 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 258 (T258A)
Ref Sequence ENSEMBL: ENSMUSP00000021888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021888]
Predicted Effect probably benign
Transcript: ENSMUST00000021888
AA Change: T258A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439
AA Change: T258A

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144401
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Ctsq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Ctsq APN 13 61037714 missense probably damaging 0.96
IGL00585:Ctsq APN 13 61037127 missense probably benign 0.00
IGL00743:Ctsq APN 13 61036184 missense probably damaging 1.00
IGL00897:Ctsq APN 13 61037725 missense probably damaging 1.00
IGL01679:Ctsq APN 13 61038908 missense probably benign 0.00
IGL01982:Ctsq APN 13 61038918 missense probably benign
IGL01982:Ctsq APN 13 61039521 missense probably benign 0.05
IGL02448:Ctsq APN 13 61036230 missense probably damaging 1.00
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0741:Ctsq UTSW 13 61036205 missense probably damaging 0.99
R1192:Ctsq UTSW 13 61039045 missense probably damaging 1.00
R1593:Ctsq UTSW 13 61036172 splice site probably null
R3906:Ctsq UTSW 13 61038771 missense probably damaging 1.00
R4483:Ctsq UTSW 13 61038912 missense probably benign 0.01
R4590:Ctsq UTSW 13 61036214 missense probably benign 0.17
R5365:Ctsq UTSW 13 61037818 missense possibly damaging 0.95
R5366:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5546:Ctsq UTSW 13 61037888 nonsense probably null
R5595:Ctsq UTSW 13 61037060 missense probably benign 0.41
R6046:Ctsq UTSW 13 61039141 missense probably benign 0.00
R6049:Ctsq UTSW 13 61038758 critical splice donor site probably null
R6535:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R6537:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R7159:Ctsq UTSW 13 61038923 missense probably benign 0.00
R8189:Ctsq UTSW 13 61037155 missense probably damaging 1.00
Z1176:Ctsq UTSW 13 61037123 missense probably benign 0.01
Z1177:Ctsq UTSW 13 61037096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCATGCAGACGTTCATATCAGG -3'
(R):5'- TTCTTCCAGGCTGTAAGTGG -3'

Sequencing Primer
(F):5'- GCAGACGTTCATATCAGGTGAAATTC -3'
(R):5'- TCTTCCAGGCTGTAAGTGGAAGTAAC -3'
Posted On2016-06-21