Incidental Mutation 'R5157:Cnmd'
ID 396797
Institutional Source Beutler Lab
Gene Symbol Cnmd
Ensembl Gene ENSMUSG00000022025
Gene Name chondromodulin
Synonyms Chondromodulin 1, Bricd3, ChM-I
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5157 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 79637690-79662170 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79656686 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 87 (Q87R)
Ref Sequence ENSEMBL: ENSMUSP00000126958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022603] [ENSMUST00000165835]
AlphaFold Q9Z1F6
Predicted Effect probably benign
Transcript: ENSMUST00000022603
AA Change: Q87R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022603
Gene: ENSMUSG00000022025
AA Change: Q87R

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165835
AA Change: Q87R

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126958
Gene: ENSMUSG00000022025
AA Change: Q87R

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphologic defects. While cartilage development and embryonic endochondral bone formation were found to be normal in mutant mice, one line of targeted mutants showed increased bone density and impairedbone resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Cnmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cnmd APN 14 79642068 splice site probably benign
IGL02556:Cnmd APN 14 79661960 missense probably benign 0.00
IGL03034:Cnmd APN 14 79641928 missense probably benign
R0529:Cnmd UTSW 14 79642041 missense probably benign 0.00
R0811:Cnmd UTSW 14 79661423 missense probably damaging 1.00
R0812:Cnmd UTSW 14 79661423 missense probably damaging 1.00
R0844:Cnmd UTSW 14 79641951 missense probably benign 0.37
R2401:Cnmd UTSW 14 79656605 missense probably damaging 0.98
R2419:Cnmd UTSW 14 79638048 missense probably damaging 1.00
R3697:Cnmd UTSW 14 79637981 missense probably damaging 1.00
R4640:Cnmd UTSW 14 79656653 missense probably damaging 1.00
R4841:Cnmd UTSW 14 79650322 missense possibly damaging 0.94
R4845:Cnmd UTSW 14 79662008 missense probably benign
R5959:Cnmd UTSW 14 79656669 missense probably damaging 1.00
R6033:Cnmd UTSW 14 79661505 missense probably benign 0.00
R6033:Cnmd UTSW 14 79661505 missense probably benign 0.00
R7421:Cnmd UTSW 14 79645507 missense probably benign 0.25
R7640:Cnmd UTSW 14 79661534 missense possibly damaging 0.86
R8007:Cnmd UTSW 14 79637966 missense probably damaging 1.00
R8350:Cnmd UTSW 14 79645381 nonsense probably null
R8450:Cnmd UTSW 14 79645381 nonsense probably null
R9009:Cnmd UTSW 14 79656645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAGAAGCTGCTGTTGAGAAC -3'
(R):5'- AGCTGACTGGTATATGGATAGATTC -3'

Sequencing Primer
(F):5'- AGTAACCACTGCGTGCGTG -3'
(R):5'- AGATGGGATCATCCTCAC -3'
Posted On 2016-06-21