Mutagenetix > Incidental Mutations

Incidental Mutation 'R5157:Ttc23l'

396798

Institutional Source

Beutler Lab

Gene Symbol

Ttc23l

Ensembl Gene

ENSMUSG00000022249

Gene Name

tetratricopeptide repeat domain 23-like

Synonyms

4930401A09Rik

MMRRC Submission

042739-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R5157 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10500102-10558668 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 10551550 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 30 (T30K)

Ref Sequence

ENSEMBL: ENSMUSP00000022857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022857
AA Change: T30K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: T30K

Domain	Start	End	E-Value	Type
TPR	159	192	4.21e1	SMART
Blast:TPR	208	239	2e-6	BLAST
TPR	250	283	1.4e1	SMART
low complexity region	292	303	N/A	INTRINSIC
TPR	376	409	9.53e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166039

SMART Domains

Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

Domain	Start	End	E-Value	Type
Blast:TPR	183	209	9e-11	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: T30K

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
Pfam:TPR_1	102	133	3.3e-6	PFAM
low complexity region	148	160	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.1531

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,686,066	S2T	probably benign	Het
Abca3	C	T	17: 24,408,122	R1266C	probably damaging	Het
Adap2	T	C	11: 80,156,946	F76S	probably damaging	Het
Adgb	T	A	10: 10,398,966	H747L	probably damaging	Het
Aox1	T	A	1: 58,070,063	V670D	probably damaging	Het
Ap4e1	A	G	2: 127,061,695	D839G	probably benign	Het
Arhgef11	T	A	3: 87,728,510		probably null	Het
AY074887	T	C	9: 54,950,818		probably benign	Het
Bicd1	C	G	6: 149,520,414	Q878E	probably benign	Het
Catspere1	A	T	1: 177,879,782		noncoding transcript	Het
Cnmd	T	C	14: 79,656,686	Q87R	probably benign	Het
Col24a1	G	T	3: 145,345,951	G661*	probably null	Het
Crtap	G	A	9: 114,384,792	L232F	probably damaging	Het
Ctsq	T	C	13: 61,037,099	T258A	probably benign	Het
Cyp2d26	T	C	15: 82,790,989	Q388R	probably benign	Het
Ddb1	A	T	19: 10,622,364	T646S	probably benign	Het
Dnah6	G	T	6: 73,195,634	S280R	probably benign	Het
Dzank1	T	C	2: 144,483,412	H545R	probably damaging	Het
Ehhadh	T	A	16: 21,766,511	M207L	probably benign	Het
Elmo2	T	A	2: 165,291,707		probably benign	Het
Golga3	G	A	5: 110,202,671	A731T	probably benign	Het
Igsf21	T	C	4: 140,028,067	T426A	possibly damaging	Het
Kcnf1	T	C	12: 17,174,741	E493G	probably benign	Het
Lmna	A	T	3: 88,484,107	D364E	probably damaging	Het
Lsr	T	C	7: 30,966,040	Y163C	probably damaging	Het
Map3k20	A	T	2: 72,438,214	T522S	probably benign	Het
Mpp5	T	A	12: 78,820,815	M324K	possibly damaging	Het
Mroh9	C	A	1: 163,044,121	A598S	probably damaging	Het
Msln	T	C	17: 25,752,983	M87V	probably benign	Het
Olfr1155	T	A	2: 87,942,888	M247L	probably benign	Het
Olfr1197	T	A	2: 88,729,548	Q17L	probably benign	Het
Olfr292	A	G	7: 86,695,232	K259E	probably benign	Het
Olfr385	T	C	11: 73,589,723	N5S	probably damaging	Het
Plekhg5	T	A	4: 152,107,865		probably benign	Het
Pprc1	G	T	19: 46,064,758		probably benign	Het
Ptprm	T	A	17: 66,957,097	K385I	probably benign	Het
Rfxap	T	A	3: 54,804,517	N215I	probably damaging	Het
Slc16a7	A	T	10: 125,233,464	Y114*	probably null	Het
Smarcb1	G	T	10: 75,911,794		probably benign	Het
Spef2	T	A	15: 9,668,791	R770*	probably null	Het
Stard9	A	T	2: 120,697,861	Y1533F	probably benign	Het
Tbcd	A	T	11: 121,610,027	Y1142F	probably benign	Het
Uba7	G	A	9: 107,980,047	V703I	probably benign	Het
Upb1	T	C	10: 75,412,804	S53P	possibly damaging	Het
Zfp672	A	G	11: 58,316,851	S215P	possibly damaging	Het
Zfp978	T	A	4: 147,390,980	L328H	probably damaging	Het

Other mutations in Ttc23l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ttc23l	APN	15	10530689	missense	probably damaging	1.00
IGL01319:Ttc23l	APN	15	10509406	splice site	probably benign
IGL01562:Ttc23l	APN	15	10551390	splice site	probably benign
IGL01969:Ttc23l	APN	15	10551434	nonsense	probably null
IGL03172:Ttc23l	APN	15	10537566	missense	probably benign	0.06
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0335:Ttc23l	UTSW	15	10539963	missense	probably benign	0.26
R0554:Ttc23l	UTSW	15	10530657	missense	probably benign	0.12
R0609:Ttc23l	UTSW	15	10504536	missense	probably benign
R0631:Ttc23l	UTSW	15	10539980	missense	probably damaging	1.00
R1703:Ttc23l	UTSW	15	10523658	missense	probably damaging	1.00
R2106:Ttc23l	UTSW	15	10547256	missense	probably damaging	1.00
R2220:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2276:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2277:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2278:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2279:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2368:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2368:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2420:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2420:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2421:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2422:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2422:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2830:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2979:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2980:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2980:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2981:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2981:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2982:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2982:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2983:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2983:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3176:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3177:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3276:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3277:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3722:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3722:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3743:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3743:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3767:Ttc23l	UTSW	15	10530695	missense	possibly damaging	0.94
R3921:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537563	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4091:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4091:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4119:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4120:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4373:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4373:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4375:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4375:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4376:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4376:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4377:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4377:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R5002:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5106:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5107:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5109:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5156:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5160:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5161:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5259:Ttc23l	UTSW	15	10515150	missense	probably damaging	0.99
R5307:Ttc23l	UTSW	15	10533659	missense	probably damaging	1.00
R5728:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5756:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5772:Ttc23l	UTSW	15	10551469	missense	probably benign	0.01
R5793:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5794:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5847:Ttc23l	UTSW	15	10537596	missense	probably benign	0.07
R6976:Ttc23l	UTSW	15	10537580	nonsense	probably null
R7010:Ttc23l	UTSW	15	10515138	missense	probably damaging	1.00
R7342:Ttc23l	UTSW	15	10551497	missense	probably benign	0.01
R7404:Ttc23l	UTSW	15	10551577	missense	probably damaging	0.98
R7453:Ttc23l	UTSW	15	10533767	missense	probably damaging	1.00
R7584:Ttc23l	UTSW	15	10533708	missense	probably damaging	1.00
R7599:Ttc23l	UTSW	15	10533680	missense	possibly damaging	0.89
Z1088:Ttc23l	UTSW	15	10533667	missense	probably damaging	1.00
Z1177:Ttc23l	UTSW	15	10533633	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATGCTTTCAAATGACAACC -3'
(R):5'- CCACACTGCTGGCTTAGAAG -3'

Sequencing Primer
(F):5'- TGCTTTCAAATGACAACCTGAAC -3'
(R):5'- CTTAGAAGCTAGGTCTTGAGAGTAG -3'

Posted On

2016-06-21