Incidental Mutation 'R5157:Cyp2d26'
ID396799
Institutional Source Beutler Lab
Gene Symbol Cyp2d26
Ensembl Gene ENSMUSG00000022445
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 26
Synonyms1300006E06Rik
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82790101-82794294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82790989 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 388 (Q388R)
Ref Sequence ENSEMBL: ENSMUSP00000006094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006094] [ENSMUST00000229387] [ENSMUST00000229512]
Predicted Effect probably benign
Transcript: ENSMUST00000006094
AA Change: Q388R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000006094
Gene: ENSMUSG00000022445
AA Change: Q388R

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:p450 37 497 3.5e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229387
Predicted Effect probably benign
Transcript: ENSMUST00000229512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230125
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Cyp2d26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cyp2d26 APN 15 82791043 missense probably benign 0.31
IGL00670:Cyp2d26 APN 15 82791741 missense probably benign
IGL01646:Cyp2d26 APN 15 82791418 missense probably benign 0.00
IGL01915:Cyp2d26 APN 15 82790249 missense probably benign 0.06
IGL01940:Cyp2d26 APN 15 82792557 missense probably benign 0.00
IGL02127:Cyp2d26 APN 15 82791106 missense probably benign 0.09
IGL02452:Cyp2d26 APN 15 82792626 missense probably benign 0.00
IGL03216:Cyp2d26 APN 15 82793261 missense probably benign
IGL03377:Cyp2d26 APN 15 82790554 missense possibly damaging 0.47
R0149:Cyp2d26 UTSW 15 82792767 missense probably damaging 1.00
R0848:Cyp2d26 UTSW 15 82790233 missense probably benign 0.00
R1165:Cyp2d26 UTSW 15 82794041 missense probably damaging 1.00
R1217:Cyp2d26 UTSW 15 82792867 splice site probably benign
R1780:Cyp2d26 UTSW 15 82794007 missense probably damaging 1.00
R2048:Cyp2d26 UTSW 15 82792727 utr 3 prime probably benign
R2152:Cyp2d26 UTSW 15 82792706 critical splice donor site probably null
R2397:Cyp2d26 UTSW 15 82794035 missense probably damaging 1.00
R4702:Cyp2d26 UTSW 15 82792447 intron probably benign
R5444:Cyp2d26 UTSW 15 82792538 missense probably benign 0.18
R6017:Cyp2d26 UTSW 15 82790573 missense possibly damaging 0.68
R6223:Cyp2d26 UTSW 15 82791717 missense probably benign 0.04
R6390:Cyp2d26 UTSW 15 82792624 missense possibly damaging 0.68
R6473:Cyp2d26 UTSW 15 82791767 missense probably benign 0.02
R6858:Cyp2d26 UTSW 15 82794083 missense probably damaging 1.00
R6912:Cyp2d26 UTSW 15 82791119 missense probably benign 0.16
R6936:Cyp2d26 UTSW 15 82792540 missense probably benign 0.14
R6960:Cyp2d26 UTSW 15 82790245 missense probably damaging 0.98
R7053:Cyp2d26 UTSW 15 82792600 missense probably benign 0.00
R7113:Cyp2d26 UTSW 15 82790202 missense probably benign 0.02
R7126:Cyp2d26 UTSW 15 82794008 missense probably benign 0.00
R7272:Cyp2d26 UTSW 15 82792563 missense probably benign
X0021:Cyp2d26 UTSW 15 82790517 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATCTGCAGTGCCTCCTACAAC -3'
(R):5'- AGATCCTATCTATCCAGGCCG -3'

Sequencing Primer
(F):5'- AAGCTCATTTCACTGGCCG -3'
(R):5'- TATCCAGGCCGTGTCCAC -3'
Posted On2016-06-21