Incidental Mutation 'R5157:Abca3'
ID 396801
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene Name ATP-binding cassette, sub-family A member 3
Synonyms Abc3, 1810036E22Rik, ABC-C
MMRRC Submission 042739-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5157 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 24570997-24629178 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24627096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1266 (R1266C)
Ref Sequence ENSEMBL: ENSMUSP00000113538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
AlphaFold Q8R420
Predicted Effect probably damaging
Transcript: ENSMUST00000039013
AA Change: R1521C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: R1521C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079594
AA Change: R1521C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: R1521C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084725
Predicted Effect probably damaging
Transcript: ENSMUST00000117337
AA Change: R1266C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: R1266C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181760
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T C 11: 80,047,772 (GRCm39) F76S probably damaging Het
Adgb T A 10: 10,274,710 (GRCm39) H747L probably damaging Het
Aox1 T A 1: 58,109,222 (GRCm39) V670D probably damaging Het
Ap4e1 A G 2: 126,903,615 (GRCm39) D839G probably benign Het
Arhgef11 T A 3: 87,635,817 (GRCm39) probably null Het
AY074887 T C 9: 54,858,102 (GRCm39) probably benign Het
Bicd1 C G 6: 149,421,912 (GRCm39) Q878E probably benign Het
Catspere1 A T 1: 177,707,348 (GRCm39) noncoding transcript Het
Cnmd T C 14: 79,894,126 (GRCm39) Q87R probably benign Het
Col24a1 G T 3: 145,051,712 (GRCm39) G661* probably null Het
Crtap G A 9: 114,213,860 (GRCm39) L232F probably damaging Het
Ctsq T C 13: 61,184,913 (GRCm39) T258A probably benign Het
Cyp2d26 T C 15: 82,675,190 (GRCm39) Q388R probably benign Het
Ddb1 A T 19: 10,599,728 (GRCm39) T646S probably benign Het
Dnah6 G T 6: 73,172,617 (GRCm39) S280R probably benign Het
Dzank1 T C 2: 144,325,332 (GRCm39) H545R probably damaging Het
Ehhadh T A 16: 21,585,261 (GRCm39) M207L probably benign Het
Elmo2 T A 2: 165,133,627 (GRCm39) probably benign Het
Golga3 G A 5: 110,350,537 (GRCm39) A731T probably benign Het
Igsf21 T C 4: 139,755,378 (GRCm39) T426A possibly damaging Het
Kcnf1 T C 12: 17,224,742 (GRCm39) E493G probably benign Het
Lmna A T 3: 88,391,414 (GRCm39) D364E probably damaging Het
Lsr T C 7: 30,665,465 (GRCm39) Y163C probably damaging Het
Map3k20 A T 2: 72,268,558 (GRCm39) T522S probably benign Het
Mroh9 C A 1: 162,871,690 (GRCm39) A598S probably damaging Het
Msln T C 17: 25,971,957 (GRCm39) M87V probably benign Het
Or14c39 A G 7: 86,344,440 (GRCm39) K259E probably benign Het
Or1e26 T C 11: 73,480,549 (GRCm39) N5S probably damaging Het
Or4a27 T A 2: 88,559,892 (GRCm39) Q17L probably benign Het
Or5d16 T A 2: 87,773,232 (GRCm39) M247L probably benign Het
Pals1 T A 12: 78,867,589 (GRCm39) M324K possibly damaging Het
Plekhg5 T A 4: 152,192,322 (GRCm39) probably benign Het
Pprc1 G T 19: 46,053,197 (GRCm39) probably benign Het
Ptprm T A 17: 67,264,092 (GRCm39) K385I probably benign Het
Rfxap T A 3: 54,711,938 (GRCm39) N215I probably damaging Het
Slc16a7 A T 10: 125,069,333 (GRCm39) Y114* probably null Het
Smarcb1 G T 10: 75,747,628 (GRCm39) probably benign Het
Spef2 T A 15: 9,668,877 (GRCm39) R770* probably null Het
Stard9 A T 2: 120,528,342 (GRCm39) Y1533F probably benign Het
Tbcd A T 11: 121,500,853 (GRCm39) Y1142F probably benign Het
Trappc2b A T 11: 51,576,893 (GRCm39) S2T probably benign Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Uba7 G A 9: 107,857,246 (GRCm39) V703I probably benign Het
Upb1 T C 10: 75,248,638 (GRCm39) S53P possibly damaging Het
Zfp672 A G 11: 58,207,677 (GRCm39) S215P possibly damaging Het
Zfp978 T A 4: 147,475,437 (GRCm39) L328H probably damaging Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24,593,220 (GRCm39) missense probably damaging 1.00
IGL01538:Abca3 APN 17 24,595,447 (GRCm39) missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24,616,327 (GRCm39) nonsense probably null
IGL01837:Abca3 APN 17 24,627,671 (GRCm39) missense probably damaging 1.00
IGL01986:Abca3 APN 17 24,627,088 (GRCm39) missense probably damaging 1.00
IGL02049:Abca3 APN 17 24,595,704 (GRCm39) nonsense probably null
IGL02186:Abca3 APN 17 24,596,714 (GRCm39) missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24,621,385 (GRCm39) missense probably benign 0.05
IGL02962:Abca3 APN 17 24,619,383 (GRCm39) missense probably damaging 1.00
IGL02963:Abca3 APN 17 24,603,503 (GRCm39) missense probably damaging 1.00
IGL03118:Abca3 APN 17 24,619,424 (GRCm39) missense probably benign 0.17
IGL03144:Abca3 APN 17 24,600,938 (GRCm39) missense probably benign 0.37
R0028:Abca3 UTSW 17 24,596,698 (GRCm39) missense probably benign 0.39
R0278:Abca3 UTSW 17 24,600,894 (GRCm39) missense probably benign 0.09
R0570:Abca3 UTSW 17 24,593,373 (GRCm39) missense probably benign
R0825:Abca3 UTSW 17 24,619,551 (GRCm39) missense probably damaging 1.00
R1164:Abca3 UTSW 17 24,621,305 (GRCm39) missense probably damaging 1.00
R1348:Abca3 UTSW 17 24,593,212 (GRCm39) splice site probably null
R1557:Abca3 UTSW 17 24,618,954 (GRCm39) missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24,596,816 (GRCm39) missense probably damaging 0.99
R1665:Abca3 UTSW 17 24,596,816 (GRCm39) missense probably damaging 0.99
R1754:Abca3 UTSW 17 24,596,753 (GRCm39) missense probably benign 0.00
R1828:Abca3 UTSW 17 24,585,171 (GRCm39) missense probably benign 0.34
R1834:Abca3 UTSW 17 24,595,666 (GRCm39) missense probably benign 0.00
R1996:Abca3 UTSW 17 24,606,506 (GRCm39) missense probably damaging 1.00
R2032:Abca3 UTSW 17 24,585,056 (GRCm39) splice site probably benign
R2100:Abca3 UTSW 17 24,627,183 (GRCm39) missense probably damaging 0.99
R2154:Abca3 UTSW 17 24,596,693 (GRCm39) missense probably damaging 1.00
R2240:Abca3 UTSW 17 24,595,417 (GRCm39) missense probably damaging 0.98
R2281:Abca3 UTSW 17 24,595,700 (GRCm39) missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24,603,538 (GRCm39) missense probably damaging 1.00
R4091:Abca3 UTSW 17 24,616,456 (GRCm39) missense probably damaging 1.00
R4294:Abca3 UTSW 17 24,619,543 (GRCm39) missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24,602,947 (GRCm39) missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24,606,503 (GRCm39) missense probably null 1.00
R4866:Abca3 UTSW 17 24,593,274 (GRCm39) missense probably damaging 0.97
R5022:Abca3 UTSW 17 24,593,274 (GRCm39) missense probably damaging 0.97
R5023:Abca3 UTSW 17 24,593,274 (GRCm39) missense probably damaging 0.97
R5072:Abca3 UTSW 17 24,593,274 (GRCm39) missense probably damaging 0.97
R5073:Abca3 UTSW 17 24,593,274 (GRCm39) missense probably damaging 0.97
R5074:Abca3 UTSW 17 24,593,274 (GRCm39) missense probably damaging 0.97
R5123:Abca3 UTSW 17 24,603,434 (GRCm39) missense possibly damaging 0.95
R5183:Abca3 UTSW 17 24,593,427 (GRCm39) missense probably benign 0.39
R5269:Abca3 UTSW 17 24,595,717 (GRCm39) missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24,602,901 (GRCm39) missense probably benign
R5579:Abca3 UTSW 17 24,595,703 (GRCm39) missense probably damaging 0.97
R5620:Abca3 UTSW 17 24,615,444 (GRCm39) missense probably benign 0.05
R5755:Abca3 UTSW 17 24,617,428 (GRCm39) missense probably damaging 1.00
R5954:Abca3 UTSW 17 24,616,390 (GRCm39) missense probably benign 0.00
R6041:Abca3 UTSW 17 24,595,354 (GRCm39) missense probably damaging 0.99
R6187:Abca3 UTSW 17 24,627,141 (GRCm39) missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24,616,526 (GRCm39) missense probably benign 0.01
R6375:Abca3 UTSW 17 24,606,536 (GRCm39) missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24,616,446 (GRCm39) missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24,603,509 (GRCm39) missense probably damaging 1.00
R6632:Abca3 UTSW 17 24,603,444 (GRCm39) missense probably benign
R6781:Abca3 UTSW 17 24,593,380 (GRCm39) missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24,627,632 (GRCm39) missense probably damaging 1.00
R6962:Abca3 UTSW 17 24,583,700 (GRCm39) missense probably benign 0.39
R7163:Abca3 UTSW 17 24,583,916 (GRCm39) missense probably benign
R7199:Abca3 UTSW 17 24,596,681 (GRCm39) missense probably damaging 1.00
R7287:Abca3 UTSW 17 24,604,861 (GRCm39) missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24,617,495 (GRCm39) missense possibly damaging 0.83
R7338:Abca3 UTSW 17 24,595,717 (GRCm39) missense possibly damaging 0.95
R7430:Abca3 UTSW 17 24,583,932 (GRCm39) critical splice donor site probably null
R7437:Abca3 UTSW 17 24,619,472 (GRCm39) missense probably damaging 0.99
R7776:Abca3 UTSW 17 24,605,250 (GRCm39) missense possibly damaging 0.77
R7805:Abca3 UTSW 17 24,624,128 (GRCm39) critical splice donor site probably null
R7811:Abca3 UTSW 17 24,616,362 (GRCm39) missense probably benign 0.00
R7848:Abca3 UTSW 17 24,603,506 (GRCm39) missense probably damaging 1.00
R7859:Abca3 UTSW 17 24,603,500 (GRCm39) missense probably damaging 1.00
R7877:Abca3 UTSW 17 24,602,997 (GRCm39) nonsense probably null
R7893:Abca3 UTSW 17 24,604,440 (GRCm39) missense probably damaging 1.00
R7910:Abca3 UTSW 17 24,604,827 (GRCm39) missense probably benign 0.09
R7911:Abca3 UTSW 17 24,617,478 (GRCm39) missense probably damaging 1.00
R7964:Abca3 UTSW 17 24,621,410 (GRCm39) missense probably benign 0.26
R8016:Abca3 UTSW 17 24,583,926 (GRCm39) missense probably benign 0.06
R8028:Abca3 UTSW 17 24,626,671 (GRCm39) missense probably benign 0.02
R8150:Abca3 UTSW 17 24,615,522 (GRCm39) missense probably benign 0.08
R8298:Abca3 UTSW 17 24,604,375 (GRCm39) missense probably damaging 1.00
R8444:Abca3 UTSW 17 24,602,959 (GRCm39) missense probably damaging 0.98
R8505:Abca3 UTSW 17 24,593,471 (GRCm39) missense probably damaging 0.97
R8547:Abca3 UTSW 17 24,616,474 (GRCm39) missense probably benign 0.00
R8699:Abca3 UTSW 17 24,627,199 (GRCm39) missense probably benign 0.01
R8903:Abca3 UTSW 17 24,602,959 (GRCm39) missense probably damaging 0.98
R9046:Abca3 UTSW 17 24,617,477 (GRCm39) missense probably damaging 1.00
R9136:Abca3 UTSW 17 24,596,807 (GRCm39) missense probably benign 0.01
R9236:Abca3 UTSW 17 24,626,712 (GRCm39) missense probably benign 0.16
R9331:Abca3 UTSW 17 24,616,324 (GRCm39) missense probably benign 0.00
R9585:Abca3 UTSW 17 24,619,486 (GRCm39) missense probably benign 0.12
R9602:Abca3 UTSW 17 24,617,378 (GRCm39) missense probably benign 0.35
R9714:Abca3 UTSW 17 24,595,702 (GRCm39) missense probably benign 0.44
X0018:Abca3 UTSW 17 24,615,454 (GRCm39) missense possibly damaging 0.63
Z1177:Abca3 UTSW 17 24,627,210 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCTAAGACAAGCTGAC -3'
(R):5'- GCCCAAACTCTCTACCTGTG -3'

Sequencing Primer
(F):5'- TGCTAAGACAAGCTGACTGGCC -3'
(R):5'- CCTGTGGGAGGTGATGACAATG -3'
Posted On 2016-06-21