Incidental Mutation 'R5157:Ddb1'
ID396805
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Namedamage specific DNA binding protein 1
SynonymsDNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10605625-10629813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10622364 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 646 (T646S)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
Predicted Effect probably benign
Transcript: ENSMUST00000025649
AA Change: T646S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: T646S

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10611664 missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10610760 missense probably benign
IGL01161:Ddb1 APN 19 10605707 start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10627660 critical splice donor site probably null
IGL01804:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10627632 missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10622466 missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10607883 missense probably benign
IGL03033:Ddb1 APN 19 10625926 missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10621861 missense probably benign 0.01
Dubitable UTSW 19 10622499 critical splice donor site probably null
Van_der_waals UTSW 19 10612916 missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10625970 missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10619246 missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10621716 missense probably benign 0.02
R0893:Ddb1 UTSW 19 10612916 missense probably benign 0.11
R1374:Ddb1 UTSW 19 10608318 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10612888 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10626764 critical splice donor site probably null
R1661:Ddb1 UTSW 19 10629080 missense probably benign 0.00
R1835:Ddb1 UTSW 19 10626593 missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10610822 splice site probably benign
R2094:Ddb1 UTSW 19 10612936 missense probably benign
R2142:Ddb1 UTSW 19 10619126 critical splice donor site probably null
R2213:Ddb1 UTSW 19 10608327 missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10626628 missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10606973 missense probably benign 0.03
R3150:Ddb1 UTSW 19 10612982 missense probably benign 0.02
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10628493 missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10627807 missense probably benign 0.00
R6244:Ddb1 UTSW 19 10625923 missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10605720 nonsense probably null
R6812:Ddb1 UTSW 19 10622499 critical splice donor site probably null
R7337:Ddb1 UTSW 19 10627831 missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10607911 critical splice donor site probably null
X0050:Ddb1 UTSW 19 10626659 missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10619230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTTGGGCTCAACATCGAG -3'
(R):5'- CGATGTCTCCAGTTAGTGACTC -3'

Sequencing Primer
(F):5'- TTTGGGCTCAACATCGAGACAGG -3'
(R):5'- AGTGACTCCTGCTTAAGACAG -3'
Posted On2016-06-21