Incidental Mutation 'R5158:Vps16'
ID 396816
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock # R5158 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 130441279 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 531 (R531C)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028900
AA Change: R531C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: R531C

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,514,829 T357I probably benign Het
Abca14 A T 7: 120,253,429 R872S probably benign Het
Adnp2 A G 18: 80,137,543 Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Iqgap1 T C 7: 80,743,068 N716D probably benign Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
Kif3a T C 11: 53,588,751 F430L probably benign Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Mpl T G 4: 118,456,684 D128A probably damaging Het
Myom3 T A 4: 135,765,586 C149S probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ndc1 T G 4: 107,375,165 S182R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptdss2 T C 7: 141,151,771 F164S probably benign Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9092:Vps16 UTSW 2 130439673 missense probably damaging 0.99
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130441903 critical splice donor site probably null
R9406:Vps16 UTSW 2 130441505 critical splice donor site probably null
R9508:Vps16 UTSW 2 130442441 missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130440485 missense probably benign 0.02
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGATGGAGGCCCTTTAGG -3'
(R):5'- CTCTCAATAGCCTTGCTCAGTG -3'

Sequencing Primer
(F):5'- CCCTTTAGGATTGGGCAGGTAAG -3'
(R):5'- TGCTCAGTGCCAGTTTGC -3'
Posted On 2016-06-21