Mutagenetix > Incidental Mutations

Incidental Mutation 'R5158:Vps16'

396816

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

042740-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R5158 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 130441279 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 531 (R531C)

Ref Sequence

ENSEMBL: ENSMUSP00000028900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028900
AA Change: R531C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: R531C

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125973

Predicted Effect

probably benign
Transcript: ENSMUST00000128994

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137084

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	C	T	17: 45,514,829	T357I	probably benign	Het
Abca14	A	T	7: 120,253,429	R872S	probably benign	Het
Adnp2	A	G	18: 80,137,543	Y47H	probably damaging	Het
Atp6v0d2	T	C	4: 19,878,292	N327S	probably damaging	Het
Ccdc190	A	G	1: 169,933,009	R69G	probably benign	Het
Cfap54	T	C	10: 93,065,197	D213G	probably damaging	Het
Clcn4	G	A	7: 7,291,619	T381I	possibly damaging	Het
Cobl	A	G	11: 12,256,198	F477S	possibly damaging	Het
Ctdspl2	T	A	2: 121,981,293	V205E	probably benign	Het
Dhx37	A	T	5: 125,415,152	Y1128N	probably damaging	Het
Ehmt2	G	A	17: 34,911,664	E1085K	probably damaging	Het
Fam149a	T	G	8: 45,350,435	I340L	possibly damaging	Het
Fut9	T	A	4: 25,620,731	I28F	probably benign	Het
Il1f9	T	A	2: 24,192,786	I191K	probably damaging	Het
Iqgap1	T	C	7: 80,743,068	N716D	probably benign	Het
Itgb7	T	C	15: 102,217,029	D672G	probably benign	Het
Kat6b	A	G	14: 21,669,986	M1469V	possibly damaging	Het
Kif3a	T	C	11: 53,588,751	F430L	probably benign	Het
L3mbtl3	T	C	10: 26,303,688	D523G	unknown	Het
Mcf2l	A	G	8: 13,009,715	Q736R	probably damaging	Het
Mpl	T	G	4: 118,456,684	D128A	probably damaging	Het
Myom3	T	A	4: 135,765,586	C149S	probably damaging	Het
N4bp2	A	G	5: 65,808,462	I1285V	probably damaging	Het
Nalcn	T	C	14: 123,515,737	Q279R	probably damaging	Het
Ndc1	T	G	4: 107,375,165	S182R	probably damaging	Het
Ngf	A	T	3: 102,520,129	M65L	possibly damaging	Het
Olfr134	T	A	17: 38,175,454	Y123*	probably null	Het
Pigb	T	C	9: 73,022,401	Y300C	probably damaging	Het
Pla2g2a	T	G	4: 138,833,284	*69G	probably null	Het
Ppp1r12b	T	C	1: 134,886,428	E379G	probably damaging	Het
Ptdss2	T	C	7: 141,151,771	F164S	probably benign	Het
Ptprc	T	C	1: 138,175,084	T2A	possibly damaging	Het
Ptprq	T	A	10: 107,534,704	N2042I	probably damaging	Het
Rdh10	A	T	1: 16,107,997	R164S	probably damaging	Het
Sec31a	A	T	5: 100,393,321	I309N	probably damaging	Het
Skint5	A	T	4: 113,742,212	I710N	unknown	Het
Slc25a30	A	T	14: 75,771,516	L26Q	probably damaging	Het
Sptan1	G	A	2: 29,978,443	V34I	probably damaging	Het
Sult1e1	A	T	5: 87,587,594	I75N	probably damaging	Het
Trpa1	A	G	1: 14,881,661	V938A	probably benign	Het
Zbtb22	C	T	17: 33,918,449	H523Y	probably damaging	Het
Zfp39	G	A	11: 58,889,845	T697M	possibly damaging	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0427:Vps16	UTSW	2	130438850	missense	probably benign	0.00
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4803:Vps16	UTSW	2	130438110	missense	probably benign	0.27
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5540:Vps16	UTSW	2	130442385	missense	probably benign	0.00
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5689:Vps16	UTSW	2	130439091	nonsense	probably null
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6135:Vps16	UTSW	2	130438653	missense	possibly damaging	0.57
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R6898:Vps16	UTSW	2	130437681	missense	possibly damaging	0.74
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGATGGAGGCCCTTTAGG -3'
(R):5'- CTCTCAATAGCCTTGCTCAGTG -3'

Sequencing Primer
(F):5'- CCCTTTAGGATTGGGCAGGTAAG -3'
(R):5'- TGCTCAGTGCCAGTTTGC -3'

Posted On

2016-06-21