Incidental Mutation 'R5158:Fut9'
ID 396819
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFUT9, mFuc-TIX
MMRRC Submission 042740-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5158 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 25609333-25800003 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25620731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 28 (I28F)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably benign
Transcript: ENSMUST00000084770
AA Change: I28F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: I28F

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108199
AA Change: I28F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: I28F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,825,755 (GRCm39) T357I probably benign Het
Abca14 A T 7: 119,852,652 (GRCm39) R872S probably benign Het
Adnp2 A G 18: 80,180,758 (GRCm39) Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 (GRCm39) N327S probably damaging Het
Ccdc190 A G 1: 169,760,578 (GRCm39) R69G probably benign Het
Cfap54 T C 10: 92,901,059 (GRCm39) D213G probably damaging Het
Clcn4 G A 7: 7,294,618 (GRCm39) T381I possibly damaging Het
Cobl A G 11: 12,206,198 (GRCm39) F477S possibly damaging Het
Ctdspl2 T A 2: 121,811,774 (GRCm39) V205E probably benign Het
Dhx37 A T 5: 125,492,216 (GRCm39) Y1128N probably damaging Het
Ehmt2 G A 17: 35,130,640 (GRCm39) E1085K probably damaging Het
Fam149a T G 8: 45,803,472 (GRCm39) I340L possibly damaging Het
Il36g T A 2: 24,082,798 (GRCm39) I191K probably damaging Het
Iqgap1 T C 7: 80,392,816 (GRCm39) N716D probably benign Het
Itgb7 T C 15: 102,125,464 (GRCm39) D672G probably benign Het
Kat6b A G 14: 21,720,054 (GRCm39) M1469V possibly damaging Het
Kif3a T C 11: 53,479,578 (GRCm39) F430L probably benign Het
L3mbtl3 T C 10: 26,179,586 (GRCm39) D523G unknown Het
Mcf2l A G 8: 13,059,715 (GRCm39) Q736R probably damaging Het
Mpl T G 4: 118,313,881 (GRCm39) D128A probably damaging Het
Myom3 T A 4: 135,492,897 (GRCm39) C149S probably damaging Het
N4bp2 A G 5: 65,965,805 (GRCm39) I1285V probably damaging Het
Nalcn T C 14: 123,753,149 (GRCm39) Q279R probably damaging Het
Ndc1 T G 4: 107,232,362 (GRCm39) S182R probably damaging Het
Ngf A T 3: 102,427,445 (GRCm39) M65L possibly damaging Het
Or2n1 T A 17: 38,486,345 (GRCm39) Y123* probably null Het
Pigb T C 9: 72,929,683 (GRCm39) Y300C probably damaging Het
Pla2g2a T G 4: 138,560,595 (GRCm39) *69G probably null Het
Ppp1r12b T C 1: 134,814,166 (GRCm39) E379G probably damaging Het
Ptdss2 T C 7: 140,731,684 (GRCm39) F164S probably benign Het
Ptprc T C 1: 138,102,822 (GRCm39) T2A possibly damaging Het
Ptprq T A 10: 107,370,565 (GRCm39) N2042I probably damaging Het
Rdh10 A T 1: 16,178,221 (GRCm39) R164S probably damaging Het
Sec31a A T 5: 100,541,180 (GRCm39) I309N probably damaging Het
Skint5 A T 4: 113,599,409 (GRCm39) I710N unknown Het
Slc25a30 A T 14: 76,008,956 (GRCm39) L26Q probably damaging Het
Sptan1 G A 2: 29,868,455 (GRCm39) V34I probably damaging Het
Sult1e1 A T 5: 87,735,453 (GRCm39) I75N probably damaging Het
Trpa1 A G 1: 14,951,885 (GRCm39) V938A probably benign Het
Vps16 C T 2: 130,283,199 (GRCm39) R531C probably damaging Het
Zbtb22 C T 17: 34,137,423 (GRCm39) H523Y probably damaging Het
Zfp39 G A 11: 58,780,671 (GRCm39) T697M possibly damaging Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25,620,316 (GRCm39) missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25,620,446 (GRCm39) missense probably benign 0.13
IGL01330:Fut9 APN 4 25,619,791 (GRCm39) missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25,619,867 (GRCm39) missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25,620,037 (GRCm39) missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25,620,802 (GRCm39) missense probably benign 0.25
R0280:Fut9 UTSW 4 25,619,852 (GRCm39) missense probably benign 0.00
R0408:Fut9 UTSW 4 25,620,319 (GRCm39) missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25,620,526 (GRCm39) missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25,620,811 (GRCm39) start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25,620,359 (GRCm39) missense probably damaging 1.00
R1567:Fut9 UTSW 4 25,620,344 (GRCm39) missense probably damaging 0.99
R1719:Fut9 UTSW 4 25,619,744 (GRCm39) missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25,620,352 (GRCm39) missense probably damaging 1.00
R2036:Fut9 UTSW 4 25,620,322 (GRCm39) missense probably damaging 1.00
R2165:Fut9 UTSW 4 25,619,734 (GRCm39) makesense probably null
R2165:Fut9 UTSW 4 25,619,733 (GRCm39) makesense probably null
R2332:Fut9 UTSW 4 25,619,823 (GRCm39) nonsense probably null
R4539:Fut9 UTSW 4 25,619,793 (GRCm39) missense probably damaging 1.00
R4722:Fut9 UTSW 4 25,799,734 (GRCm39) utr 5 prime probably benign
R4766:Fut9 UTSW 4 25,799,191 (GRCm39) intron probably benign
R4937:Fut9 UTSW 4 25,799,591 (GRCm39) splice site probably benign
R5025:Fut9 UTSW 4 25,620,502 (GRCm39) missense probably damaging 1.00
R5032:Fut9 UTSW 4 25,799,245 (GRCm39) intron probably benign
R5601:Fut9 UTSW 4 25,620,299 (GRCm39) missense probably benign 0.00
R5974:Fut9 UTSW 4 25,620,090 (GRCm39) nonsense probably null
R6315:Fut9 UTSW 4 25,619,774 (GRCm39) missense probably damaging 1.00
R6385:Fut9 UTSW 4 25,620,328 (GRCm39) missense probably damaging 1.00
R6652:Fut9 UTSW 4 25,620,619 (GRCm39) missense probably benign 0.44
R6809:Fut9 UTSW 4 25,620,647 (GRCm39) missense probably benign
R6825:Fut9 UTSW 4 25,619,925 (GRCm39) missense probably benign
R7145:Fut9 UTSW 4 25,620,507 (GRCm39) missense probably damaging 0.96
R7573:Fut9 UTSW 4 25,620,691 (GRCm39) missense probably benign 0.04
R8933:Fut9 UTSW 4 25,619,861 (GRCm39) missense probably damaging 1.00
R9715:Fut9 UTSW 4 25,620,679 (GRCm39) missense probably benign 0.00
X0057:Fut9 UTSW 4 25,799,686 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTTGTGAGATGGCACCCTTG -3'
(R):5'- CTGAAAGGGAATTAGAGTTGGTTTC -3'

Sequencing Primer
(F):5'- GGCACCCTTGGATATTGAACATTGC -3'
(R):5'- CTCTCTTCCCCAGGAAAAATT -3'
Posted On 2016-06-21