Incidental Mutation 'R5158:Ndc1'
ID396820
Institutional Source Beutler Lab
Gene Symbol Ndc1
Ensembl Gene ENSMUSG00000028614
Gene NameNDC1 transmembrane nucleoporin
Synonymssks, Tmem48, 2810475A17Rik
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R5158 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location107367784-107416346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107375165 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 182 (S182R)
Ref Sequence ENSEMBL: ENSMUSP00000120365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030357] [ENSMUST00000125342] [ENSMUST00000139560] [ENSMUST00000149366]
Predicted Effect probably benign
Transcript: ENSMUST00000030357
Predicted Effect probably benign
Transcript: ENSMUST00000125342
Predicted Effect probably damaging
Transcript: ENSMUST00000139560
AA Change: S182R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120365
Gene: ENSMUSG00000028614
AA Change: S182R

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 20 666 1.7e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149366
AA Change: S182R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137180
Gene: ENSMUSG00000028614
AA Change: S182R

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 19 511 3.7e-136 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene produce background sensitive growth rates and skeletal anomalies. Both females and males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,514,829 T357I probably benign Het
Abca14 A T 7: 120,253,429 R872S probably benign Het
Adnp2 A G 18: 80,137,543 Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Iqgap1 T C 7: 80,743,068 N716D probably benign Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
Kif3a T C 11: 53,588,751 F430L probably benign Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Mpl T G 4: 118,456,684 D128A probably damaging Het
Myom3 T A 4: 135,765,586 C149S probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptdss2 T C 7: 141,151,771 F164S probably benign Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Vps16 C T 2: 130,441,279 R531C probably damaging Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Ndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ndc1 APN 4 107384780 splice site probably benign
IGL00929:Ndc1 APN 4 107389497 missense probably benign 0.23
IGL01340:Ndc1 APN 4 107374147 missense probably damaging 1.00
IGL01376:Ndc1 APN 4 107375197 missense probably damaging 1.00
IGL01954:Ndc1 APN 4 107395804 missense probably damaging 1.00
IGL02290:Ndc1 APN 4 107394995 splice site probably benign
IGL03251:Ndc1 APN 4 107380659 missense possibly damaging 0.50
R1168:Ndc1 UTSW 4 107395812 missense probably benign 0.02
R1541:Ndc1 UTSW 4 107371288 nonsense probably null
R1605:Ndc1 UTSW 4 107368096 missense probably damaging 0.96
R1612:Ndc1 UTSW 4 107395068 splice site probably benign
R1716:Ndc1 UTSW 4 107384795 missense probably damaging 1.00
R3522:Ndc1 UTSW 4 107393158 missense probably damaging 0.99
R4036:Ndc1 UTSW 4 107411072 missense probably benign 0.22
R4698:Ndc1 UTSW 4 107411137 missense probably benign 0.06
R4794:Ndc1 UTSW 4 107390222 missense probably benign 0.03
R5053:Ndc1 UTSW 4 107374218 missense probably damaging 1.00
R5097:Ndc1 UTSW 4 107374161 missense probably benign 0.01
R5217:Ndc1 UTSW 4 107389576 missense probably benign
R5579:Ndc1 UTSW 4 107380704 missense possibly damaging 0.74
R5666:Ndc1 UTSW 4 107389526 missense possibly damaging 0.52
R5855:Ndc1 UTSW 4 107383707 missense probably damaging 1.00
R6180:Ndc1 UTSW 4 107411198 missense possibly damaging 0.65
R6525:Ndc1 UTSW 4 107368107 missense probably benign 0.01
R8065:Ndc1 UTSW 4 107390398 missense probably benign 0.01
R8067:Ndc1 UTSW 4 107390398 missense probably benign 0.01
R8100:Ndc1 UTSW 4 107383605 missense possibly damaging 0.94
Z1176:Ndc1 UTSW 4 107386602 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTTGGAATTTTGCCTTCTGG -3'
(R):5'- GCGAGCTGGGATTACAGACATC -3'

Sequencing Primer
(F):5'- GCAAATAGCCTTAAAACAACAGTG -3'
(R):5'- ACCTTCATGGGCCTGAGCTTG -3'
Posted On2016-06-21