Incidental Mutation 'R0452:Nlrp4d'
ID39683
Institutional Source Beutler Lab
Gene Symbol Nlrp4d
Ensembl Gene ENSMUSG00000034122
Gene NameNLR family, pyrin domain containing 4D
SynonymsNalp4d, Nalp-beta
MMRRC Submission 038652-MU
Accession Numbers

Genbank: XM_001481310; Ensembl: ENSMUST00000184509

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0452 (G1)
Quality Score205
Status Validated
Chromosome7
Chromosomal Location10358862-10388935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10378292 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 650 (T650I)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000086269
AA Change: T650I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000083450
Gene: ENSMUSG00000034122
AA Change: T650I

DomainStartEndE-ValueType
PYRIN 6 89 2.6e-31 SMART
Pfam:NACHT 150 318 2.4e-34 PFAM
low complexity region 575 586 N/A INTRINSIC
LRR 674 701 1.3e-1 SMART
Blast:LRR 703 729 8e-7 BLAST
LRR 730 756 2.1e-2 SMART
LRR 758 785 2.1e-1 SMART
LRR 786 813 1.6e-5 SMART
LRR 814 837 3.5e-1 SMART
LRR 838 865 2.7e-6 SMART
LRR 867 894 7.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182420
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Nlrp4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nlrp4d APN 7 10382094 exon noncoding transcript
IGL01076:Nlrp4d APN 7 10372083 missense unknown 0.00
IGL01656:Nlrp4d APN 7 10364147 missense noncoding transcript
IGL01889:Nlrp4d APN 7 10378334 missense unknown 0.00
IGL02110:Nlrp4d APN 7 10382564 exon noncoding transcript
IGL02271:Nlrp4d APN 7 10388698 exon noncoding transcript
IGL02637:Nlrp4d APN 7 10382555 exon noncoding transcript
snoop UTSW 7 10374891 missense probably benign 0.02
1mM(1):Nlrp4d UTSW 7 10381713 missense probably benign 0.09
F5493:Nlrp4d UTSW 7 10381084 missense possibly damaging 0.84
IGL03048:Nlrp4d UTSW 7 10358954 unclassified noncoding transcript
R0116:Nlrp4d UTSW 7 10374891 missense probably benign 0.02
R0125:Nlrp4d UTSW 7 10382389 missense probably damaging 1.00
R0390:Nlrp4d UTSW 7 10388778 missense probably benign 0.04
R0595:Nlrp4d UTSW 7 10381045 missense probably benign 0.00
R0729:Nlrp4d UTSW 7 10377685 critical splice donor site probably benign
R0733:Nlrp4d UTSW 7 10382522 missense probably benign 0.02
R1147:Nlrp4d UTSW 7 10388717 missense probably benign 0.00
R1217:Nlrp4d UTSW 7 10364267 missense probably benign 0.36
R1378:Nlrp4d UTSW 7 10364184 missense probably benign 0.23
R1414:Nlrp4d UTSW 7 10382601 missense probably benign 0.22
R1583:Nlrp4d UTSW 7 10382237 missense probably damaging 0.99
R1585:Nlrp4d UTSW 7 10382510 missense probably benign 0.02
R1882:Nlrp4d UTSW 7 10382677 critical splice acceptor site noncoding transcript
R2422:Nlrp4d UTSW 7 10362945 missense probably benign 0.29
R2907:Nlrp4d UTSW 7 10378427 missense probably benign 0.00
R2964:Nlrp4d UTSW 7 10378329 nonsense probably null
R2974:Nlrp4d UTSW 7 10378440 critical splice acceptor site probably benign
R3401:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R3402:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R4240:Nlrp4d UTSW 7 10381316 missense noncoding transcript
R4682:Nlrp4d UTSW 7 10374952 missense noncoding transcript
R4766:Nlrp4d UTSW 7 10362779 critical splice donor site unknown
R4864:Nlrp4d UTSW 7 10381161 missense noncoding transcript
R4910:Nlrp4d UTSW 7 10378409 exon noncoding transcript
R5307:Nlrp4d UTSW 7 10362782 nonsense probably null
R5596:Nlrp4d UTSW 7 10382024 missense noncoding transcript
R5857:Nlrp4d UTSW 7 10382377 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- CATGTGCTCACCATCATAGAAGGTCAC -3'
(R):5'- CCATTCTCCTCTGTTACAGGGAAAAGG -3'

Sequencing Primer
(F):5'- atatgcttccatcatcctacaattc -3'
(R):5'- GGGAAAAGGTACTTGACTGTTGG -3'
Posted On2013-05-23