Incidental Mutation 'R5158:Iqgap1'
ID396832
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5158 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80743068 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 716 (N716D)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
Predicted Effect probably benign
Transcript: ENSMUST00000167377
AA Change: N716D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: N716D

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205383
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,514,829 T357I probably benign Het
Abca14 A T 7: 120,253,429 R872S probably benign Het
Adnp2 A G 18: 80,137,543 Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
Kif3a T C 11: 53,588,751 F430L probably benign Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Mpl T G 4: 118,456,684 D128A probably damaging Het
Myom3 T A 4: 135,765,586 C149S probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ndc1 T G 4: 107,375,165 S182R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptdss2 T C 7: 141,151,771 F164S probably benign Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Vps16 C T 2: 130,441,279 R531C probably damaging Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80759839 missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80723030 nonsense probably null
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80730100 missense probably damaging 1.00
R7615:Iqgap1 UTSW 7 80751346 missense probably benign
R7726:Iqgap1 UTSW 7 80757456 missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80809059 missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80738169 missense probably damaging 1.00
R7862:Iqgap1 UTSW 7 80743888 missense probably benign 0.04
R8270:Iqgap1 UTSW 7 80730127 missense probably damaging 1.00
RF004:Iqgap1 UTSW 7 80720875 missense probably benign
RF063:Iqgap1 UTSW 7 80723751 frame shift probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Z1176:Iqgap1 UTSW 7 80768309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCCACCCAACTTTTAAGAAC -3'
(R):5'- CTGACCAGAGTAATCAGTGTGGG -3'

Sequencing Primer
(F):5'- GTTGTACAACTGACATGTTTTCCATC -3'
(R):5'- CAGAGTAATCAGTGTGGGGGTGTG -3'
Posted On2016-06-21