Incidental Mutation 'R5158:Aars2'
ID396853
Institutional Source Beutler Lab
Gene Symbol Aars2
Ensembl Gene ENSMUSG00000023938
Gene Namealanyl-tRNA synthetase 2, mitochondrial
SynonymsAarsl
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5158 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45506841-45520842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45514829 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 357 (T357I)
Ref Sequence ENSEMBL: ENSMUSP00000024733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024733]
Predicted Effect probably benign
Transcript: ENSMUST00000024733
AA Change: T357I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: T357I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:tRNA-synt_2c 36 619 4e-175 PFAM
low complexity region 663 674 N/A INTRINSIC
tRNA_SAD 716 774 2.65e-10 SMART
coiled coil region 833 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,253,429 R872S probably benign Het
Adnp2 A G 18: 80,137,543 Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Iqgap1 T C 7: 80,743,068 N716D probably benign Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
Kif3a T C 11: 53,588,751 F430L probably benign Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Mpl T G 4: 118,456,684 D128A probably damaging Het
Myom3 T A 4: 135,765,586 C149S probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ndc1 T G 4: 107,375,165 S182R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptdss2 T C 7: 141,151,771 F164S probably benign Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Vps16 C T 2: 130,441,279 R531C probably damaging Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Aars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02958:Aars2 APN 17 45518172 missense probably benign 0.00
dread_pirate UTSW 17 45516564 missense probably damaging 1.00
R0266:Aars2 UTSW 17 45507510 splice site probably benign
R0315:Aars2 UTSW 17 45515452 missense possibly damaging 0.67
R0375:Aars2 UTSW 17 45514550 missense probably damaging 0.99
R0629:Aars2 UTSW 17 45507547 missense probably damaging 0.99
R0981:Aars2 UTSW 17 45520331 missense probably damaging 1.00
R1878:Aars2 UTSW 17 45514638 critical splice donor site probably null
R1893:Aars2 UTSW 17 45514799 missense probably benign 0.14
R2035:Aars2 UTSW 17 45514801 missense possibly damaging 0.87
R2099:Aars2 UTSW 17 45506894 missense unknown
R4342:Aars2 UTSW 17 45516495 missense probably benign
R4600:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4601:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4610:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R5943:Aars2 UTSW 17 45517711 missense probably benign 0.30
R5992:Aars2 UTSW 17 45508623 nonsense probably null
R6255:Aars2 UTSW 17 45514609 missense probably damaging 1.00
R6381:Aars2 UTSW 17 45518545 missense probably benign 0.04
R6392:Aars2 UTSW 17 45514600 missense probably damaging 0.98
R6406:Aars2 UTSW 17 45506939 missense probably benign 0.16
R6648:Aars2 UTSW 17 45516564 missense probably damaging 1.00
R7135:Aars2 UTSW 17 45508961 nonsense probably null
R7197:Aars2 UTSW 17 45508959 missense probably damaging 1.00
R7203:Aars2 UTSW 17 45516571 missense probably damaging 1.00
R7289:Aars2 UTSW 17 45507624 missense probably damaging 0.99
R7669:Aars2 UTSW 17 45520295 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACACTCAGTGTCTGCATTGC -3'
(R):5'- AGCAAGACCAGCTCTCTCAG -3'

Sequencing Primer
(F):5'- GCATTGCTGACGGTGTCTCC -3'
(R):5'- TCTCAGCCTCCTTGACGGG -3'
Posted On2016-06-21