Incidental Mutation 'R5160:Prkcz'
ID396925
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
MMRRC Submission 042742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5160 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155293232 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 79 (V79D)
Ref Sequence ENSEMBL: ENSMUSP00000116042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178] [ENSMUST00000123652] [ENSMUST00000131975]
Predicted Effect probably benign
Transcript: ENSMUST00000030922
AA Change: V187D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: V187D

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103178
AA Change: V4D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053
AA Change: V4D

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123652
AA Change: V4D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125320
Predicted Effect probably benign
Transcript: ENSMUST00000131975
AA Change: V79D

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116042
Gene: ENSMUSG00000029053
AA Change: V79D

DomainStartEndE-ValueType
C1 23 72 6.73e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145373
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,712,197 P681L probably benign Het
Akap9 A G 5: 4,030,007 R1920G probably damaging Het
Ano9 G A 7: 141,104,365 R495C probably damaging Het
Apoa5 A G 9: 46,270,496 Y290C probably damaging Het
Apob T C 12: 8,012,126 I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,655 K823T probably damaging Het
Bicc1 T C 10: 70,932,236 Y850C probably damaging Het
Cdh2 A T 18: 16,629,587 D433E probably damaging Het
Cfap100 A G 6: 90,413,710 probably null Het
Col6a5 T C 9: 105,931,009 N947D unknown Het
Col8a2 A G 4: 126,310,412 K72E possibly damaging Het
Ddx18 A G 1: 121,565,879 probably null Het
Dna2 T C 10: 62,947,154 V21A probably benign Het
Dnaja3 T A 16: 4,684,288 M52K probably benign Het
Fnip2 G A 3: 79,488,991 T504I probably damaging Het
Il18 G A 9: 50,577,893 probably null Het
Ina T A 19: 47,015,080 I109N probably damaging Het
Katnb1 G T 8: 95,095,470 V275L probably benign Het
Kdm6b C A 11: 69,400,768 probably benign Het
Kifc2 T A 15: 76,662,977 L251Q probably damaging Het
Kmt2d A G 15: 98,840,224 probably benign Het
Lcor T A 19: 41,555,614 V82E probably damaging Het
Limk2 A C 11: 3,350,772 V190G probably damaging Het
Luc7l A G 17: 26,267,297 D150G probably benign Het
Magi3 T A 3: 104,027,908 H903L possibly damaging Het
Mdh1b C T 1: 63,725,645 R33Q probably null Het
Myo9a T C 9: 59,871,802 F1614L probably benign Het
Ngly1 A G 14: 16,281,751 T210A probably damaging Het
Oas1h A G 5: 120,871,082 Y285C probably damaging Het
Olfr1252 T C 2: 89,721,419 R231G probably damaging Het
Olfr1382 T C 11: 49,535,689 L168P probably damaging Het
Olfr1413 C T 1: 92,573,822 T217I probably benign Het
Olfr209 C T 16: 59,361,766 G151R probably damaging Het
Olfr364-ps1 T A 2: 37,146,803 M197K probably benign Het
Olfr91 T C 17: 37,093,724 D50G possibly damaging Het
Osbpl7 T C 11: 97,054,556 S81P probably damaging Het
Pcdha3 T C 18: 36,946,427 V74A probably damaging Het
Pi4ka T C 16: 17,323,053 D68G probably benign Het
Ptpn12 T A 5: 20,997,831 I650F probably damaging Het
Rb1 A G 14: 73,264,455 silent Het
Rnaseh2b T G 14: 62,353,531 Y56* probably null Het
Ryr3 A T 2: 112,646,927 C4495S probably damaging Het
Tk1 A G 11: 117,824,746 I45T possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upp1 T C 11: 9,135,193 S227P possibly damaging Het
Vmn1r30 T A 6: 58,435,383 N155Y probably benign Het
Wdr35 C T 12: 9,008,487 A548V probably damaging Het
Zc3h3 A T 15: 75,809,663 M523K probably benign Het
Zc3h4 T C 7: 16,434,648 L894P unknown Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp873 C T 10: 82,061,042 H536Y possibly damaging Het
Zmym4 A T 4: 126,870,184 N1354K probably damaging Het
Zscan20 A G 4: 128,592,482 S142P possibly damaging Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1686:Prkcz UTSW 4 155271256 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4399:Prkcz UTSW 4 155269077 missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155289634 missense probably benign 0.01
R7108:Prkcz UTSW 4 155286793 nonsense probably null
R7241:Prkcz UTSW 4 155269059 missense probably benign 0.00
R7355:Prkcz UTSW 4 155357496 missense probably damaging 1.00
R7466:Prkcz UTSW 4 155271602 missense probably damaging 1.00
R7522:Prkcz UTSW 4 155271285 missense probably damaging 1.00
R7618:Prkcz UTSW 4 155262482 missense probably damaging 1.00
R7753:Prkcz UTSW 4 155272968 missense possibly damaging 0.61
R8079:Prkcz UTSW 4 155357505 missense probably damaging 1.00
R8407:Prkcz UTSW 4 155268216 missense probably damaging 0.99
R8523:Prkcz UTSW 4 155262511 missense probably damaging 1.00
R8824:Prkcz UTSW 4 155344828 start gained probably benign
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Z1176:Prkcz UTSW 4 155354680 missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155356468 missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155301004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTTCCAGCCCAACTCAC -3'
(R):5'- CCCAGCAGCTGTCGTTTATAC -3'

Sequencing Primer
(F):5'- TCACCCACATTGACTCTTAGAG -3'
(R):5'- GCGTATTTTATACACACACACGCG -3'
Posted On2016-06-21