Incidental Mutation 'R5160:Oas1h'
ID 396928
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 042742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R5160 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 120861421-120873506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120871082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 285 (Y285C)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: Y285C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: Y285C

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171820
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,712,197 P681L probably benign Het
Akap9 A G 5: 4,030,007 R1920G probably damaging Het
Ano9 G A 7: 141,104,365 R495C probably damaging Het
Apoa5 A G 9: 46,270,496 Y290C probably damaging Het
Apob T C 12: 8,012,126 I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,655 K823T probably damaging Het
Bicc1 T C 10: 70,932,236 Y850C probably damaging Het
Cdh2 A T 18: 16,629,587 D433E probably damaging Het
Cfap100 A G 6: 90,413,710 probably null Het
Col6a5 T C 9: 105,931,009 N947D unknown Het
Col8a2 A G 4: 126,310,412 K72E possibly damaging Het
Ddx18 A G 1: 121,565,879 probably null Het
Dna2 T C 10: 62,947,154 V21A probably benign Het
Dnaja3 T A 16: 4,684,288 M52K probably benign Het
Fnip2 G A 3: 79,488,991 T504I probably damaging Het
Il18 G A 9: 50,577,893 probably null Het
Ina T A 19: 47,015,080 I109N probably damaging Het
Katnb1 G T 8: 95,095,470 V275L probably benign Het
Kdm6b C A 11: 69,400,768 probably benign Het
Kifc2 T A 15: 76,662,977 L251Q probably damaging Het
Kmt2d A G 15: 98,840,224 probably benign Het
Lcor T A 19: 41,555,614 V82E probably damaging Het
Limk2 A C 11: 3,350,772 V190G probably damaging Het
Luc7l A G 17: 26,267,297 D150G probably benign Het
Magi3 T A 3: 104,027,908 H903L possibly damaging Het
Mdh1b C T 1: 63,725,645 R33Q probably null Het
Myo9a T C 9: 59,871,802 F1614L probably benign Het
Ngly1 A G 14: 16,281,751 T210A probably damaging Het
Olfr1252 T C 2: 89,721,419 R231G probably damaging Het
Olfr1382 T C 11: 49,535,689 L168P probably damaging Het
Olfr1413 C T 1: 92,573,822 T217I probably benign Het
Olfr209 C T 16: 59,361,766 G151R probably damaging Het
Olfr364-ps1 T A 2: 37,146,803 M197K probably benign Het
Olfr91 T C 17: 37,093,724 D50G possibly damaging Het
Osbpl7 T C 11: 97,054,556 S81P probably damaging Het
Pcdha3 T C 18: 36,946,427 V74A probably damaging Het
Pi4ka T C 16: 17,323,053 D68G probably benign Het
Prkcz A T 4: 155,293,232 V79D probably benign Het
Ptpn12 T A 5: 20,997,831 I650F probably damaging Het
Rb1 A G 14: 73,264,455 silent Het
Rnaseh2b T G 14: 62,353,531 Y56* probably null Het
Ryr3 A T 2: 112,646,927 C4495S probably damaging Het
Tk1 A G 11: 117,824,746 I45T possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upp1 T C 11: 9,135,193 S227P possibly damaging Het
Vmn1r30 T A 6: 58,435,383 N155Y probably benign Het
Wdr35 C T 12: 9,008,487 A548V probably damaging Het
Zc3h3 A T 15: 75,809,663 M523K probably benign Het
Zc3h4 T C 7: 16,434,648 L894P unknown Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp873 C T 10: 82,061,042 H536Y possibly damaging Het
Zmym4 A T 4: 126,870,184 N1354K probably damaging Het
Zscan20 A G 4: 128,592,482 S142P possibly damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 120871834 missense probably damaging 1.00
IGL01890:Oas1h APN 5 120862789 splice site probably null
IGL02745:Oas1h APN 5 120861479 missense probably benign 0.04
IGL02888:Oas1h APN 5 120861547 missense probably benign 0.34
IGL02970:Oas1h APN 5 120861635 missense possibly damaging 0.91
R0125:Oas1h UTSW 5 120862563 nonsense probably null
R1261:Oas1h UTSW 5 120871867 missense probably benign 0.01
R1506:Oas1h UTSW 5 120871888 missense possibly damaging 0.66
R1565:Oas1h UTSW 5 120862600 missense probably damaging 0.97
R1696:Oas1h UTSW 5 120862822 critical splice donor site probably null
R1750:Oas1h UTSW 5 120871777 splice site probably null
R3116:Oas1h UTSW 5 120861616 nonsense probably null
R4814:Oas1h UTSW 5 120862665 missense probably damaging 0.99
R4906:Oas1h UTSW 5 120867109 nonsense probably null
R4944:Oas1h UTSW 5 120862783 missense probably damaging 1.00
R4961:Oas1h UTSW 5 120871096 missense probably damaging 1.00
R5698:Oas1h UTSW 5 120870982 missense probably damaging 1.00
R5903:Oas1h UTSW 5 120870977 missense probably damaging 1.00
R6014:Oas1h UTSW 5 120867166 missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120861465 unclassified probably benign
R7966:Oas1h UTSW 5 120871899 missense probably damaging 0.97
R7975:Oas1h UTSW 5 120871827 missense probably damaging 1.00
R8777:Oas1h UTSW 5 120867044 missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 120867044 missense probably damaging 1.00
R8951:Oas1h UTSW 5 120862594 missense probably damaging 1.00
R8987:Oas1h UTSW 5 120867089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGATGAGAGCCTCTTGTTTC -3'
(R):5'- TTAGGACCTCATGTCAGTCCG -3'

Sequencing Primer
(F):5'- ATGAGAGCCTCTTGTTTCTTATTGC -3'
(R):5'- ACCTCATGTCAGTCCGGTGAC -3'
Posted On 2016-06-21