Incidental Mutation 'R5160:Oas1h'
ID 396928
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 042742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5160 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 120999485-121011569 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121009145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 285 (Y285C)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: Y285C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: Y285C

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171820
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,662,197 (GRCm39) P681L probably benign Het
Akap9 A G 5: 4,080,007 (GRCm39) R1920G probably damaging Het
Ano9 G A 7: 140,684,278 (GRCm39) R495C probably damaging Het
Apoa5 A G 9: 46,181,794 (GRCm39) Y290C probably damaging Het
Apob T C 12: 8,062,126 (GRCm39) I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,656 (GRCm39) K823T probably damaging Het
Bicc1 T C 10: 70,768,066 (GRCm39) Y850C probably damaging Het
Cdh2 A T 18: 16,762,644 (GRCm39) D433E probably damaging Het
Cfap100 A G 6: 90,390,692 (GRCm39) probably null Het
Col6a5 T C 9: 105,808,208 (GRCm39) N947D unknown Het
Col8a2 A G 4: 126,204,205 (GRCm39) K72E possibly damaging Het
Ddx18 A G 1: 121,493,608 (GRCm39) probably null Het
Dna2 T C 10: 62,782,933 (GRCm39) V21A probably benign Het
Dnaja3 T A 16: 4,502,152 (GRCm39) M52K probably benign Het
Fnip2 G A 3: 79,396,298 (GRCm39) T504I probably damaging Het
Il18 G A 9: 50,489,193 (GRCm39) probably null Het
Ina T A 19: 47,003,519 (GRCm39) I109N probably damaging Het
Katnb1 G T 8: 95,822,098 (GRCm39) V275L probably benign Het
Kdm6b C A 11: 69,291,594 (GRCm39) probably benign Het
Kifc2 T A 15: 76,547,177 (GRCm39) L251Q probably damaging Het
Kmt2d A G 15: 98,738,105 (GRCm39) probably benign Het
Lcor T A 19: 41,544,053 (GRCm39) V82E probably damaging Het
Limk2 A C 11: 3,300,772 (GRCm39) V190G probably damaging Het
Luc7l A G 17: 26,486,271 (GRCm39) D150G probably benign Het
Magi3 T A 3: 103,935,224 (GRCm39) H903L possibly damaging Het
Mdh1b C T 1: 63,764,804 (GRCm39) R33Q probably null Het
Myo9a T C 9: 59,779,085 (GRCm39) F1614L probably benign Het
Ngly1 A G 14: 16,281,751 (GRCm38) T210A probably damaging Het
Or1l4b T A 2: 37,036,815 (GRCm39) M197K probably benign Het
Or2h1 T C 17: 37,404,616 (GRCm39) D50G possibly damaging Het
Or2y12 T C 11: 49,426,516 (GRCm39) L168P probably damaging Het
Or4a79 T C 2: 89,551,763 (GRCm39) R231G probably damaging Het
Or5ac25 C T 16: 59,182,129 (GRCm39) G151R probably damaging Het
Or9s23 C T 1: 92,501,544 (GRCm39) T217I probably benign Het
Osbpl7 T C 11: 96,945,382 (GRCm39) S81P probably damaging Het
Pcdha3 T C 18: 37,079,480 (GRCm39) V74A probably damaging Het
Pi4ka T C 16: 17,140,917 (GRCm39) D68G probably benign Het
Prkcz A T 4: 155,377,689 (GRCm39) V79D probably benign Het
Ptpn12 T A 5: 21,202,829 (GRCm39) I650F probably damaging Het
Rb1 A G 14: 73,501,895 (GRCm39) silent Het
Rnaseh2b T G 14: 62,590,980 (GRCm39) Y56* probably null Het
Ryr3 A T 2: 112,477,272 (GRCm39) C4495S probably damaging Het
Tk1 A G 11: 117,715,572 (GRCm39) I45T possibly damaging Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Upp1 T C 11: 9,085,193 (GRCm39) S227P possibly damaging Het
Vmn1r30 T A 6: 58,412,368 (GRCm39) N155Y probably benign Het
Wdr35 C T 12: 9,058,487 (GRCm39) A548V probably damaging Het
Zc3h3 A T 15: 75,681,512 (GRCm39) M523K probably benign Het
Zc3h4 T C 7: 16,168,573 (GRCm39) L894P unknown Het
Zfp790 C T 7: 29,529,192 (GRCm39) H626Y probably benign Het
Zfp873 C T 10: 81,896,876 (GRCm39) H536Y possibly damaging Het
Zmym4 A T 4: 126,763,977 (GRCm39) N1354K probably damaging Het
Zscan20 A G 4: 128,486,275 (GRCm39) S142P possibly damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 121,009,897 (GRCm39) missense probably damaging 1.00
IGL01890:Oas1h APN 5 121,000,852 (GRCm39) splice site probably null
IGL02745:Oas1h APN 5 120,999,542 (GRCm39) missense probably benign 0.04
IGL02888:Oas1h APN 5 120,999,610 (GRCm39) missense probably benign 0.34
IGL02970:Oas1h APN 5 120,999,698 (GRCm39) missense possibly damaging 0.91
R0125:Oas1h UTSW 5 121,000,626 (GRCm39) nonsense probably null
R1261:Oas1h UTSW 5 121,009,930 (GRCm39) missense probably benign 0.01
R1506:Oas1h UTSW 5 121,009,951 (GRCm39) missense possibly damaging 0.66
R1565:Oas1h UTSW 5 121,000,663 (GRCm39) missense probably damaging 0.97
R1696:Oas1h UTSW 5 121,000,885 (GRCm39) critical splice donor site probably null
R1750:Oas1h UTSW 5 121,009,840 (GRCm39) splice site probably null
R3116:Oas1h UTSW 5 120,999,679 (GRCm39) nonsense probably null
R4814:Oas1h UTSW 5 121,000,728 (GRCm39) missense probably damaging 0.99
R4906:Oas1h UTSW 5 121,005,172 (GRCm39) nonsense probably null
R4944:Oas1h UTSW 5 121,000,846 (GRCm39) missense probably damaging 1.00
R4961:Oas1h UTSW 5 121,009,159 (GRCm39) missense probably damaging 1.00
R5698:Oas1h UTSW 5 121,009,045 (GRCm39) missense probably damaging 1.00
R5903:Oas1h UTSW 5 121,009,040 (GRCm39) missense probably damaging 1.00
R6014:Oas1h UTSW 5 121,005,229 (GRCm39) missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120,999,528 (GRCm39) unclassified probably benign
R7966:Oas1h UTSW 5 121,009,962 (GRCm39) missense probably damaging 0.97
R7975:Oas1h UTSW 5 121,009,890 (GRCm39) missense probably damaging 1.00
R8777:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8951:Oas1h UTSW 5 121,000,657 (GRCm39) missense probably damaging 1.00
R8987:Oas1h UTSW 5 121,005,152 (GRCm39) missense probably damaging 1.00
R9748:Oas1h UTSW 5 121,005,088 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGATGAGAGCCTCTTGTTTC -3'
(R):5'- TTAGGACCTCATGTCAGTCCG -3'

Sequencing Primer
(F):5'- ATGAGAGCCTCTTGTTTCTTATTGC -3'
(R):5'- ACCTCATGTCAGTCCGGTGAC -3'
Posted On 2016-06-21