Mutagenetix > Incidental Mutations

Incidental Mutation 'R5160:Myo9a'

396939

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

042742-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5160 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59871802 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1614 (F1614L)

Ref Sequence

ENSEMBL: ENSMUSP00000117432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

Predicted Effect

probably benign
Transcript: ENSMUST00000128341
AA Change: F1614L

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: F1614L

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135298
AA Change: F1614L

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: F1614L

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136740
AA Change: F1614L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: F1614L

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147364

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215963

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aftph	G	A	11: 20,712,197	P681L	probably benign	Het
Akap9	A	G	5: 4,030,007	R1920G	probably damaging	Het
Ano9	G	A	7: 141,104,365	R495C	probably damaging	Het
Apoa5	A	G	9: 46,270,496	Y290C	probably damaging	Het
Apob	T	C	12: 8,012,126	I3536T	possibly damaging	Het
Arhgap42	T	G	9: 8,997,655	K823T	probably damaging	Het
Bicc1	T	C	10: 70,932,236	Y850C	probably damaging	Het
Cdh2	A	T	18: 16,629,587	D433E	probably damaging	Het
Cfap100	A	G	6: 90,413,710		probably null	Het
Col6a5	T	C	9: 105,931,009	N947D	unknown	Het
Col8a2	A	G	4: 126,310,412	K72E	possibly damaging	Het
Ddx18	A	G	1: 121,565,879		probably null	Het
Dna2	T	C	10: 62,947,154	V21A	probably benign	Het
Dnaja3	T	A	16: 4,684,288	M52K	probably benign	Het
Fnip2	G	A	3: 79,488,991	T504I	probably damaging	Het
Il18	G	A	9: 50,577,893		probably null	Het
Ina	T	A	19: 47,015,080	I109N	probably damaging	Het
Katnb1	G	T	8: 95,095,470	V275L	probably benign	Het
Kdm6b	C	A	11: 69,400,768		probably benign	Het
Kifc2	T	A	15: 76,662,977	L251Q	probably damaging	Het
Kmt2d	A	G	15: 98,840,224		probably benign	Het
Lcor	T	A	19: 41,555,614	V82E	probably damaging	Het
Limk2	A	C	11: 3,350,772	V190G	probably damaging	Het
Luc7l	A	G	17: 26,267,297	D150G	probably benign	Het
Magi3	T	A	3: 104,027,908	H903L	possibly damaging	Het
Mdh1b	C	T	1: 63,725,645	R33Q	probably null	Het
Ngly1	A	G	14: 16,281,751	T210A	probably damaging	Het
Oas1h	A	G	5: 120,871,082	Y285C	probably damaging	Het
Olfr1252	T	C	2: 89,721,419	R231G	probably damaging	Het
Olfr1382	T	C	11: 49,535,689	L168P	probably damaging	Het
Olfr1413	C	T	1: 92,573,822	T217I	probably benign	Het
Olfr209	C	T	16: 59,361,766	G151R	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,803	M197K	probably benign	Het
Olfr91	T	C	17: 37,093,724	D50G	possibly damaging	Het
Osbpl7	T	C	11: 97,054,556	S81P	probably damaging	Het
Pcdha3	T	C	18: 36,946,427	V74A	probably damaging	Het
Pi4ka	T	C	16: 17,323,053	D68G	probably benign	Het
Prkcz	A	T	4: 155,293,232	V79D	probably benign	Het
Ptpn12	T	A	5: 20,997,831	I650F	probably damaging	Het
Rb1	A	G	14: 73,264,455		silent	Het
Rnaseh2b	T	G	14: 62,353,531	Y56*	probably null	Het
Ryr3	A	T	2: 112,646,927	C4495S	probably damaging	Het
Tk1	A	G	11: 117,824,746	I45T	possibly damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Upp1	T	C	11: 9,135,193	S227P	possibly damaging	Het
Vmn1r30	T	A	6: 58,435,383	N155Y	probably benign	Het
Wdr35	C	T	12: 9,008,487	A548V	probably damaging	Het
Zc3h3	A	T	15: 75,809,663	M523K	probably benign	Het
Zc3h4	T	C	7: 16,434,648	L894P	unknown	Het
Zfp790	C	T	7: 29,829,767	H626Y	probably benign	Het
Zfp873	C	T	10: 82,061,042	H536Y	possibly damaging	Het
Zmym4	A	T	4: 126,870,184	N1354K	probably damaging	Het
Zscan20	A	G	4: 128,592,482	S142P	possibly damaging	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0329:Myo9a	UTSW	9	59923677	missense	probably damaging	1.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0784:Myo9a	UTSW	9	59896545	splice site	probably benign
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1698:Myo9a	UTSW	9	59868181	missense	probably benign	0.05
R1715:Myo9a	UTSW	9	59832300	missense	probably damaging	0.99
R1981:Myo9a	UTSW	9	59894146	missense	probably benign
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4610:Myo9a	UTSW	9	59871882	missense	probably benign
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6194:Myo9a	UTSW	9	59869750	missense	probably benign	0.00
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7107:Myo9a	UTSW	9	59870815	missense	probably benign	0.44
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGACAATTGAACAGTCACG -3'
(R):5'- GGAAGGGTCATCAGATCTGTGG -3'

Sequencing Primer
(F):5'- ACGAACTGAGGCCTCTGTCTTG -3'
(R):5'- GTCATCAGATCTGTGGCTGTAAAAG -3'

Posted On

2016-06-21