Incidental Mutation 'R5160:Bicc1'
ID396943
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 042742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5160 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70932236 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 850 (Y850C)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably damaging
Transcript: ENSMUST00000014473
AA Change: Y850C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: Y850C

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058942
Predicted Effect probably damaging
Transcript: ENSMUST00000131445
AA Change: Y768C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: Y768C

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: Y850C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: Y850C

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218757
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,712,197 P681L probably benign Het
Akap9 A G 5: 4,030,007 R1920G probably damaging Het
Ano9 G A 7: 141,104,365 R495C probably damaging Het
Apoa5 A G 9: 46,270,496 Y290C probably damaging Het
Apob T C 12: 8,012,126 I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,655 K823T probably damaging Het
Cdh2 A T 18: 16,629,587 D433E probably damaging Het
Cfap100 A G 6: 90,413,710 probably null Het
Col6a5 T C 9: 105,931,009 N947D unknown Het
Col8a2 A G 4: 126,310,412 K72E possibly damaging Het
Ddx18 A G 1: 121,565,879 probably null Het
Dna2 T C 10: 62,947,154 V21A probably benign Het
Dnaja3 T A 16: 4,684,288 M52K probably benign Het
Fnip2 G A 3: 79,488,991 T504I probably damaging Het
Il18 G A 9: 50,577,893 probably null Het
Ina T A 19: 47,015,080 I109N probably damaging Het
Katnb1 G T 8: 95,095,470 V275L probably benign Het
Kdm6b C A 11: 69,400,768 probably benign Het
Kifc2 T A 15: 76,662,977 L251Q probably damaging Het
Kmt2d A G 15: 98,840,224 probably benign Het
Lcor T A 19: 41,555,614 V82E probably damaging Het
Limk2 A C 11: 3,350,772 V190G probably damaging Het
Luc7l A G 17: 26,267,297 D150G probably benign Het
Magi3 T A 3: 104,027,908 H903L possibly damaging Het
Mdh1b C T 1: 63,725,645 R33Q probably null Het
Myo9a T C 9: 59,871,802 F1614L probably benign Het
Ngly1 A G 14: 16,281,751 T210A probably damaging Het
Oas1h A G 5: 120,871,082 Y285C probably damaging Het
Olfr1252 T C 2: 89,721,419 R231G probably damaging Het
Olfr1382 T C 11: 49,535,689 L168P probably damaging Het
Olfr1413 C T 1: 92,573,822 T217I probably benign Het
Olfr209 C T 16: 59,361,766 G151R probably damaging Het
Olfr364-ps1 T A 2: 37,146,803 M197K probably benign Het
Olfr91 T C 17: 37,093,724 D50G possibly damaging Het
Osbpl7 T C 11: 97,054,556 S81P probably damaging Het
Pcdha3 T C 18: 36,946,427 V74A probably damaging Het
Pi4ka T C 16: 17,323,053 D68G probably benign Het
Prkcz A T 4: 155,293,232 V79D probably benign Het
Ptpn12 T A 5: 20,997,831 I650F probably damaging Het
Rb1 A G 14: 73,264,455 silent Het
Rnaseh2b T G 14: 62,353,531 Y56* probably null Het
Ryr3 A T 2: 112,646,927 C4495S probably damaging Het
Tk1 A G 11: 117,824,746 I45T possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upp1 T C 11: 9,135,193 S227P possibly damaging Het
Vmn1r30 T A 6: 58,435,383 N155Y probably benign Het
Wdr35 C T 12: 9,008,487 A548V probably damaging Het
Zc3h3 A T 15: 75,809,663 M523K probably benign Het
Zc3h4 T C 7: 16,434,648 L894P unknown Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp873 C T 10: 82,061,042 H536Y possibly damaging Het
Zmym4 A T 4: 126,870,184 N1354K probably damaging Het
Zscan20 A G 4: 128,592,482 S142P possibly damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGATGCCCAGGAAGCTG -3'
(R):5'- TAACCTCCGAATGGCAGGAG -3'

Sequencing Primer
(F):5'- AGGAAGCTGGCTGACCTCTTG -3'
(R):5'- AGTAAACAGCAGCGTCTCCTTGG -3'
Posted On2016-06-21