Incidental Mutation 'R0452:Elovl5'
ID39696
Institutional Source Beutler Lab
Gene Symbol Elovl5
Ensembl Gene ENSMUSG00000032349
Gene NameELOVL family member 5, elongation of long chain fatty acids (yeast)
Synonyms1110059L23Rik
MMRRC Submission 038652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0452 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location77917364-77984519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77960911 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 35 (T35M)
Ref Sequence ENSEMBL: ENSMUSP00000120171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034904] [ENSMUST00000133757] [ENSMUST00000134072]
Predicted Effect probably damaging
Transcript: ENSMUST00000034904
AA Change: T35M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034904
Gene: ENSMUSG00000032349
AA Change: T35M

DomainStartEndE-ValueType
Pfam:ELO 27 262 2.3e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133757
AA Change: T35M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123121
Gene: ENSMUSG00000032349
AA Change: T35M

DomainStartEndE-ValueType
Pfam:ELO 27 180 4.6e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134072
AA Change: T35M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120171
Gene: ENSMUSG00000032349
AA Change: T35M

DomainStartEndE-ValueType
Pfam:ELO 27 70 3.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148398
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele have defects in fatty acid synthesis in the liver that result in hepatic steatosis. Also, majority of female mice have defects in female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smarcad1 A T 6: 65,074,822 N313I possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Elovl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Elovl5 APN 9 77960974 missense probably benign 0.12
IGL01017:Elovl5 APN 9 77981571 missense possibly damaging 0.67
IGL02331:Elovl5 APN 9 77979899 missense possibly damaging 0.81
IGL02851:Elovl5 APN 9 77981502 missense probably damaging 1.00
IGL03011:Elovl5 APN 9 77982784 missense probably benign 0.32
laid-up UTSW 9 77981502 missense probably damaging 0.99
R0494:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R3706:Elovl5 UTSW 9 77979837 missense probably null 1.00
R4353:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R6211:Elovl5 UTSW 9 77981502 missense probably damaging 0.99
R6640:Elovl5 UTSW 9 77979913 nonsense probably null
R7804:Elovl5 UTSW 9 77979823 critical splice acceptor site probably null
RF031:Elovl5 UTSW 9 77981473 critical splice acceptor site probably null
Z1176:Elovl5 UTSW 9 77976755 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GTCTGATCATGGCCGAGCCAATAG -3'
(R):5'- GCCTTTCTTCACGTAGGGACACAC -3'

Sequencing Primer
(F):5'- TGAAGGGCACACTGCTTG -3'
(R):5'- TAGGGACACACCTCAGGC -3'
Posted On2013-05-23