Incidental Mutation 'R5160:Luc7l'
ID 396965
Institutional Source Beutler Lab
Gene Symbol Luc7l
Ensembl Gene ENSMUSG00000024188
Gene Name Luc7-like
Synonyms
MMRRC Submission 042742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock # R5160 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 26252910-26285504 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26267297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 150 (D150G)
Ref Sequence ENSEMBL: ENSMUSP00000110627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025023] [ENSMUST00000114976] [ENSMUST00000119928] [ENSMUST00000140427] [ENSMUST00000148894] [ENSMUST00000152107] [ENSMUST00000154235] [ENSMUST00000155151]
AlphaFold Q9CYI4
Predicted Effect probably benign
Transcript: ENSMUST00000025023
AA Change: D150G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025023
Gene: ENSMUSG00000024188
AA Change: D150G

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114976
AA Change: D150G

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110627
Gene: ENSMUSG00000024188
AA Change: D150G

DomainStartEndE-ValueType
Pfam:LUC7 5 249 2.5e-85 PFAM
low complexity region 327 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119928
AA Change: D150G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113405
Gene: ENSMUSG00000024188
AA Change: D150G

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133032
Predicted Effect probably benign
Transcript: ENSMUST00000140427
AA Change: D64G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122258
Gene: ENSMUSG00000024188
AA Change: D64G

DomainStartEndE-ValueType
Pfam:LUC7 1 168 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148894
Predicted Effect unknown
Transcript: ENSMUST00000152107
AA Change: D8G
SMART Domains Protein: ENSMUSP00000119717
Gene: ENSMUSG00000024188
AA Change: D8G

DomainStartEndE-ValueType
coiled coil region 8 55 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154235
Predicted Effect probably benign
Transcript: ENSMUST00000155151
SMART Domains Protein: ENSMUSP00000120409
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 1 69 7.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162696
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 [PubMed 11170747]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a mutant allele producing a truncated product lacked any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,712,197 P681L probably benign Het
Akap9 A G 5: 4,030,007 R1920G probably damaging Het
Ano9 G A 7: 141,104,365 R495C probably damaging Het
Apoa5 A G 9: 46,270,496 Y290C probably damaging Het
Apob T C 12: 8,012,126 I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,655 K823T probably damaging Het
Bicc1 T C 10: 70,932,236 Y850C probably damaging Het
Cdh2 A T 18: 16,629,587 D433E probably damaging Het
Cfap100 A G 6: 90,413,710 probably null Het
Col6a5 T C 9: 105,931,009 N947D unknown Het
Col8a2 A G 4: 126,310,412 K72E possibly damaging Het
Ddx18 A G 1: 121,565,879 probably null Het
Dna2 T C 10: 62,947,154 V21A probably benign Het
Dnaja3 T A 16: 4,684,288 M52K probably benign Het
Fnip2 G A 3: 79,488,991 T504I probably damaging Het
Il18 G A 9: 50,577,893 probably null Het
Ina T A 19: 47,015,080 I109N probably damaging Het
Katnb1 G T 8: 95,095,470 V275L probably benign Het
Kdm6b C A 11: 69,400,768 probably benign Het
Kifc2 T A 15: 76,662,977 L251Q probably damaging Het
Kmt2d A G 15: 98,840,224 probably benign Het
Lcor T A 19: 41,555,614 V82E probably damaging Het
Limk2 A C 11: 3,350,772 V190G probably damaging Het
Magi3 T A 3: 104,027,908 H903L possibly damaging Het
Mdh1b C T 1: 63,725,645 R33Q probably null Het
Myo9a T C 9: 59,871,802 F1614L probably benign Het
Ngly1 A G 14: 16,281,751 T210A probably damaging Het
Oas1h A G 5: 120,871,082 Y285C probably damaging Het
Olfr1252 T C 2: 89,721,419 R231G probably damaging Het
Olfr1382 T C 11: 49,535,689 L168P probably damaging Het
Olfr1413 C T 1: 92,573,822 T217I probably benign Het
Olfr209 C T 16: 59,361,766 G151R probably damaging Het
Olfr364-ps1 T A 2: 37,146,803 M197K probably benign Het
Olfr91 T C 17: 37,093,724 D50G possibly damaging Het
Osbpl7 T C 11: 97,054,556 S81P probably damaging Het
Pcdha3 T C 18: 36,946,427 V74A probably damaging Het
Pi4ka T C 16: 17,323,053 D68G probably benign Het
Prkcz A T 4: 155,293,232 V79D probably benign Het
Ptpn12 T A 5: 20,997,831 I650F probably damaging Het
Rb1 A G 14: 73,264,455 silent Het
Rnaseh2b T G 14: 62,353,531 Y56* probably null Het
Ryr3 A T 2: 112,646,927 C4495S probably damaging Het
Tk1 A G 11: 117,824,746 I45T possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upp1 T C 11: 9,135,193 S227P possibly damaging Het
Vmn1r30 T A 6: 58,435,383 N155Y probably benign Het
Wdr35 C T 12: 9,008,487 A548V probably damaging Het
Zc3h3 A T 15: 75,809,663 M523K probably benign Het
Zc3h4 T C 7: 16,434,648 L894P unknown Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp873 C T 10: 82,061,042 H536Y possibly damaging Het
Zmym4 A T 4: 126,870,184 N1354K probably damaging Het
Zscan20 A G 4: 128,592,482 S142P possibly damaging Het
Other mutations in Luc7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Luc7l APN 17 26279340 utr 3 prime probably benign
IGL02141:Luc7l APN 17 26253080 missense probably damaging 1.00
R0658:Luc7l UTSW 17 26266322 missense probably damaging 1.00
R1114:Luc7l UTSW 17 26275858 splice site probably benign
R1868:Luc7l UTSW 17 26280056 utr 3 prime probably benign
R2112:Luc7l UTSW 17 26255127 critical splice donor site probably null
R2286:Luc7l UTSW 17 26280046 utr 3 prime probably benign
R2864:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R2865:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R3040:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4319:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4384:Luc7l UTSW 17 26279962 splice site probably benign
R5330:Luc7l UTSW 17 26275733 nonsense probably null
R5331:Luc7l UTSW 17 26275733 nonsense probably null
R7220:Luc7l UTSW 17 26253245 start gained probably benign
R7418:Luc7l UTSW 17 26253182 unclassified probably benign
R7559:Luc7l UTSW 17 26255115 missense probably damaging 1.00
R8077:Luc7l UTSW 17 26255073 missense probably damaging 1.00
R8203:Luc7l UTSW 17 26266359 missense possibly damaging 0.95
R8895:Luc7l UTSW 17 26254004 missense possibly damaging 0.46
X0026:Luc7l UTSW 17 26277575 missense probably damaging 1.00
Z1088:Luc7l UTSW 17 26267255 missense probably damaging 0.96
Z1177:Luc7l UTSW 17 26281661 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTTATTTTCAGGGGAATAGGCC -3'
(R):5'- TCAGCCAGCACAATAAAGGGAAA -3'

Sequencing Primer
(F):5'- TTTTCAGGGGAATAGGCCAGACATG -3'
(R):5'- GCCTTTATCCCAGCGATAAGG -3'
Posted On 2016-06-21