Incidental Mutation 'R5160:Lcor'
ID396969
Institutional Source Beutler Lab
Gene Symbol Lcor
Ensembl Gene ENSMUSG00000025019
Gene Nameligand dependent nuclear receptor corepressor
SynonymsA630025C20Rik, Mlr2, 3110023F06Rik
MMRRC Submission 042742-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R5160 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41482645-41562246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41555614 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 82 (V82E)
Ref Sequence ENSEMBL: ENSMUSP00000126441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067795] [ENSMUST00000163929]
Predicted Effect probably damaging
Transcript: ENSMUST00000067795
AA Change: V82E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067603
Gene: ENSMUSG00000025019
AA Change: V82E

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 1.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163929
AA Change: V82E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126441
Gene: ENSMUSG00000025019
AA Change: V82E

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 5.1e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCOR is a transcriptional corepressor widely expressed in fetal and adult tissues that is recruited to agonist-bound nuclear receptors through a single LxxLL motif, also referred to as a nuclear receptor (NR) box (Fernandes et al., 2003 [PubMed 12535528]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,712,197 P681L probably benign Het
Akap9 A G 5: 4,030,007 R1920G probably damaging Het
Ano9 G A 7: 141,104,365 R495C probably damaging Het
Apoa5 A G 9: 46,270,496 Y290C probably damaging Het
Apob T C 12: 8,012,126 I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,655 K823T probably damaging Het
Bicc1 T C 10: 70,932,236 Y850C probably damaging Het
Cdh2 A T 18: 16,629,587 D433E probably damaging Het
Cfap100 A G 6: 90,413,710 probably null Het
Col6a5 T C 9: 105,931,009 N947D unknown Het
Col8a2 A G 4: 126,310,412 K72E possibly damaging Het
Ddx18 A G 1: 121,565,879 probably null Het
Dna2 T C 10: 62,947,154 V21A probably benign Het
Dnaja3 T A 16: 4,684,288 M52K probably benign Het
Fnip2 G A 3: 79,488,991 T504I probably damaging Het
Il18 G A 9: 50,577,893 probably null Het
Ina T A 19: 47,015,080 I109N probably damaging Het
Katnb1 G T 8: 95,095,470 V275L probably benign Het
Kdm6b C A 11: 69,400,768 probably benign Het
Kifc2 T A 15: 76,662,977 L251Q probably damaging Het
Kmt2d A G 15: 98,840,224 probably benign Het
Limk2 A C 11: 3,350,772 V190G probably damaging Het
Luc7l A G 17: 26,267,297 D150G probably benign Het
Magi3 T A 3: 104,027,908 H903L possibly damaging Het
Mdh1b C T 1: 63,725,645 R33Q probably null Het
Myo9a T C 9: 59,871,802 F1614L probably benign Het
Ngly1 A G 14: 16,281,751 T210A probably damaging Het
Oas1h A G 5: 120,871,082 Y285C probably damaging Het
Olfr1252 T C 2: 89,721,419 R231G probably damaging Het
Olfr1382 T C 11: 49,535,689 L168P probably damaging Het
Olfr1413 C T 1: 92,573,822 T217I probably benign Het
Olfr209 C T 16: 59,361,766 G151R probably damaging Het
Olfr364-ps1 T A 2: 37,146,803 M197K probably benign Het
Olfr91 T C 17: 37,093,724 D50G possibly damaging Het
Osbpl7 T C 11: 97,054,556 S81P probably damaging Het
Pcdha3 T C 18: 36,946,427 V74A probably damaging Het
Pi4ka T C 16: 17,323,053 D68G probably benign Het
Prkcz A T 4: 155,293,232 V79D probably benign Het
Ptpn12 T A 5: 20,997,831 I650F probably damaging Het
Rb1 A G 14: 73,264,455 silent Het
Rnaseh2b T G 14: 62,353,531 Y56* probably null Het
Ryr3 A T 2: 112,646,927 C4495S probably damaging Het
Tk1 A G 11: 117,824,746 I45T possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upp1 T C 11: 9,135,193 S227P possibly damaging Het
Vmn1r30 T A 6: 58,435,383 N155Y probably benign Het
Wdr35 C T 12: 9,008,487 A548V probably damaging Het
Zc3h3 A T 15: 75,809,663 M523K probably benign Het
Zc3h4 T C 7: 16,434,648 L894P unknown Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp873 C T 10: 82,061,042 H536Y possibly damaging Het
Zmym4 A T 4: 126,870,184 N1354K probably damaging Het
Zscan20 A G 4: 128,592,482 S142P possibly damaging Het
Other mutations in Lcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lcor APN 19 41552700 missense probably damaging 0.97
IGL02079:Lcor APN 19 41555687 missense probably benign 0.40
IGL02100:Lcor APN 19 41558754 missense possibly damaging 0.93
IGL02444:Lcor APN 19 41559011 missense probably damaging 0.99
IGL02578:Lcor APN 19 41559150 missense probably damaging 1.00
IGL03072:Lcor APN 19 41558814 missense possibly damaging 0.85
IGL03118:Lcor APN 19 41558369 missense probably damaging 0.99
IGL03153:Lcor APN 19 41558356 missense probably damaging 0.98
R1756:Lcor UTSW 19 41559266 missense probably benign
R1889:Lcor UTSW 19 41559128 missense probably damaging 0.99
R1913:Lcor UTSW 19 41558474 missense probably benign 0.40
R1983:Lcor UTSW 19 41558367 missense probably damaging 0.98
R3885:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3886:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3888:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3889:Lcor UTSW 19 41558356 missense probably damaging 0.98
R6112:Lcor UTSW 19 41559081 missense possibly damaging 0.92
R7777:Lcor UTSW 19 41558795 missense probably benign 0.33
R8556:Lcor UTSW 19 41558424 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGACAAGAAATTTTGCCCTGAG -3'
(R):5'- TTTTAATGCTCAAGGAAGCTGG -3'

Sequencing Primer
(F):5'- GAAATTTTGCCCTGAGAAATACATG -3'
(R):5'- TGCTCAAGGAAGCTGGCTGATTAG -3'
Posted On2016-06-21