Incidental Mutation 'R5161:Ehmt1'
ID396974
Institutional Source Beutler Lab
Gene Symbol Ehmt1
Ensembl Gene ENSMUSG00000036893
Gene Nameeuchromatic histone methyltransferase 1
SynonymsKMT1D, 9230102N17Rik
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24789928-24919614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24858195 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 407 (D407G)
Ref Sequence ENSEMBL: ENSMUSP00000110061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046227] [ENSMUST00000091348] [ENSMUST00000102938] [ENSMUST00000114418] [ENSMUST00000114432] [ENSMUST00000147147] [ENSMUST00000200655]
Predicted Effect probably benign
Transcript: ENSMUST00000046227
AA Change: D407G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046077
Gene: ENSMUSG00000036893
AA Change: D407G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091348
AA Change: D399G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088906
Gene: ENSMUSG00000036893
AA Change: D399G

DomainStartEndE-ValueType
low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 763 792 2.02e-5 SMART
ANK 796 827 3.06e-5 SMART
ANK 829 859 1.69e-7 SMART
ANK 863 892 6.65e-6 SMART
ANK 896 925 7.71e-2 SMART
ANK 929 958 6.12e-5 SMART
ANK 962 995 7.29e2 SMART
PreSET 1002 1101 1.05e-30 SMART
SET 1117 1240 2.24e-43 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102938
AA Change: D400G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100002
Gene: ENSMUSG00000036893
AA Change: D400G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 770 799 2.02e-5 SMART
ANK 803 834 3.06e-5 SMART
ANK 836 866 1.69e-7 SMART
ANK 870 899 6.65e-6 SMART
ANK 903 932 7.71e-2 SMART
ANK 936 965 6.12e-5 SMART
ANK 969 1002 7.29e2 SMART
PreSET 1009 1108 1.05e-30 SMART
SET 1124 1247 2.24e-43 SMART
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114418
AA Change: D407G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110061
Gene: ENSMUSG00000036893
AA Change: D407G

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114432
AA Change: D400G

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110075
Gene: ENSMUSG00000036893
AA Change: D400G

DomainStartEndE-ValueType
low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 717 746 2.02e-5 SMART
ANK 750 781 3.06e-5 SMART
ANK 783 813 1.69e-7 SMART
ANK 817 846 6.65e-6 SMART
ANK 850 879 7.71e-2 SMART
ANK 883 912 6.12e-5 SMART
ANK 916 949 7.29e2 SMART
PreSET 956 1055 1.05e-30 SMART
SET 1071 1194 2.24e-43 SMART
low complexity region 1211 1224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139000
Predicted Effect probably benign
Transcript: ENSMUST00000147147
AA Change: D407G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119057
Gene: ENSMUSG00000036893
AA Change: D407G

DomainStartEndE-ValueType
low complexity region 252 271 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 352 364 N/A INTRINSIC
ANK 634 663 2.02e-5 SMART
ANK 667 698 3.06e-5 SMART
ANK 700 730 1.69e-7 SMART
ANK 734 763 6.65e-6 SMART
ANK 767 796 7.71e-2 SMART
ANK 800 829 6.12e-5 SMART
ANK 833 866 7.29e2 SMART
PreSET 873 972 1.05e-30 SMART
SET 988 1111 2.24e-43 SMART
low complexity region 1128 1141 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152325
AA Change: D155G
SMART Domains Protein: ENSMUSP00000123387
Gene: ENSMUSG00000036893
AA Change: D155G

DomainStartEndE-ValueType
low complexity region 89 108 N/A INTRINSIC
low complexity region 147 168 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200655
Predicted Effect probably benign
Transcript: ENSMUST00000207383
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that is part of the E2F6 complex, which represses transcription. The encoded protein methylates the Lys-9 position of histone H3, which tags it for transcriptional repression. This protein may be involved in the silencing of MYC- and E2F-responsive genes and therefore could play a role in the G0/G1 cell cycle transition. Defects in this gene are a cause of chromosome 9q subtelomeric deletion syndrome (9q-syndrome, also known as Kleefstra syndrome). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Nullizygous embryos die circa E9.5 showing delayed growth and incomplete somite formation and neural groove closure. Heterozygotes show behavioral deficits and synaptic dysfunction. Homozygotes with a H3K9me1-binding mutant form show delayed prenatal growth and bone ossification and postnatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Ehmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ehmt1 APN 2 24838818 missense possibly damaging 0.81
IGL01403:Ehmt1 APN 2 24839626 missense possibly damaging 0.81
IGL01636:Ehmt1 APN 2 24839608 missense probably damaging 0.97
IGL01804:Ehmt1 APN 2 24791954 missense probably damaging 1.00
IGL01836:Ehmt1 APN 2 24863220 splice site probably null
IGL02740:Ehmt1 APN 2 24815839 splice site probably benign
IGL02750:Ehmt1 APN 2 24863869 missense probably damaging 1.00
IGL03026:Ehmt1 APN 2 24852734 missense probably benign
IGL02799:Ehmt1 UTSW 2 24815806 missense probably damaging 1.00
R0908:Ehmt1 UTSW 2 24804888 missense probably damaging 1.00
R1275:Ehmt1 UTSW 2 24886995 critical splice donor site probably null
R1665:Ehmt1 UTSW 2 24877464 missense probably damaging 1.00
R1707:Ehmt1 UTSW 2 24805138 missense probably benign
R1800:Ehmt1 UTSW 2 24884290 missense probably damaging 0.99
R2108:Ehmt1 UTSW 2 24837618 missense probably damaging 1.00
R2113:Ehmt1 UTSW 2 24804003 missense probably damaging 1.00
R2393:Ehmt1 UTSW 2 24806217 missense probably damaging 1.00
R2570:Ehmt1 UTSW 2 24815741 missense probably damaging 1.00
R3923:Ehmt1 UTSW 2 24884335 splice site probably null
R4646:Ehmt1 UTSW 2 24891684 missense probably null 0.01
R4924:Ehmt1 UTSW 2 24839722 missense probably damaging 0.97
R4989:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5040:Ehmt1 UTSW 2 24884304 missense probably benign 0.19
R5110:Ehmt1 UTSW 2 24852790 missense probably benign 0.01
R5133:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5134:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5162:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5183:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5184:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5208:Ehmt1 UTSW 2 24801533 missense probably benign 0.34
R5309:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5312:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5837:Ehmt1 UTSW 2 24863914 missense probably damaging 0.98
R5968:Ehmt1 UTSW 2 24836457 missense probably damaging 0.99
R6539:Ehmt1 UTSW 2 24804767 missense probably damaging 1.00
R6646:Ehmt1 UTSW 2 24806310 missense probably damaging 0.99
R7065:Ehmt1 UTSW 2 24840697 missense probably damaging 1.00
R7226:Ehmt1 UTSW 2 24804782 missense probably damaging 1.00
R7361:Ehmt1 UTSW 2 24856701 missense possibly damaging 0.94
R7373:Ehmt1 UTSW 2 24919573 start codon destroyed probably null 0.03
R7410:Ehmt1 UTSW 2 24848068 missense probably benign
R7418:Ehmt1 UTSW 2 24884634 missense probably benign 0.02
R7633:Ehmt1 UTSW 2 24815780 missense possibly damaging 0.68
R7716:Ehmt1 UTSW 2 24884499 missense probably damaging 0.99
R7916:Ehmt1 UTSW 2 24856696 missense probably damaging 1.00
R8112:Ehmt1 UTSW 2 24863384 missense probably damaging 1.00
R8356:Ehmt1 UTSW 2 24852769 missense probably benign
X0062:Ehmt1 UTSW 2 24863836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTAACGGATCTCACAAG -3'
(R):5'- ACAGCTTGTTTCTACCTTGCGG -3'

Sequencing Primer
(F):5'- GCTAACGGATCTCACAAGGACATAAG -3'
(R):5'- TTTCTACCTTGCGGGCAGACAG -3'
Posted On2016-06-21