Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Ehmt1'

396974

Institutional Source

Beutler Lab

Gene Symbol

Ehmt1

Ensembl Gene

ENSMUSG00000036893

Gene Name

euchromatic histone methyltransferase 1

Synonyms

KMT1D, 9230102N17Rik

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24789928-24919614 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24858195 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 407 (D407G)

Ref Sequence

ENSEMBL: ENSMUSP00000110061 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046227] [ENSMUST00000091348] [ENSMUST00000102938] [ENSMUST00000114418] [ENSMUST00000114432] [ENSMUST00000147147] [ENSMUST00000200655]

Predicted Effect

probably benign
Transcript: ENSMUST00000046227
AA Change: D407G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000046077
Gene: ENSMUSG00000036893
AA Change: D407G

Domain	Start	End	E-Value	Type
low complexity region	340	359	N/A	INTRINSIC
low complexity region	398	419	N/A	INTRINSIC
low complexity region	440	452	N/A	INTRINSIC
ANK	722	751	2.02e-5	SMART
ANK	755	786	3.06e-5	SMART
ANK	788	818	1.69e-7	SMART
ANK	822	851	6.65e-6	SMART
ANK	855	884	7.71e-2	SMART
ANK	888	917	6.12e-5	SMART
ANK	921	954	7.29e2	SMART
PreSET	961	1060	1.05e-30	SMART
SET	1076	1199	2.24e-43	SMART
low complexity region	1216	1229	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000091348
AA Change: D399G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000088906
Gene: ENSMUSG00000036893
AA Change: D399G

Domain	Start	End	E-Value	Type
low complexity region	333	352	N/A	INTRINSIC
low complexity region	391	412	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
ANK	763	792	2.02e-5	SMART
ANK	796	827	3.06e-5	SMART
ANK	829	859	1.69e-7	SMART
ANK	863	892	6.65e-6	SMART
ANK	896	925	7.71e-2	SMART
ANK	929	958	6.12e-5	SMART
ANK	962	995	7.29e2	SMART
PreSET	1002	1101	1.05e-30	SMART
SET	1117	1240	2.24e-43	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102938
AA Change: D400G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000100002
Gene: ENSMUSG00000036893
AA Change: D400G

Domain	Start	End	E-Value	Type
low complexity region	340	359	N/A	INTRINSIC
low complexity region	398	419	N/A	INTRINSIC
low complexity region	440	452	N/A	INTRINSIC
ANK	770	799	2.02e-5	SMART
ANK	803	834	3.06e-5	SMART
ANK	836	866	1.69e-7	SMART
ANK	870	899	6.65e-6	SMART
ANK	903	932	7.71e-2	SMART
ANK	936	965	6.12e-5	SMART
ANK	969	1002	7.29e2	SMART
PreSET	1009	1108	1.05e-30	SMART
SET	1124	1247	2.24e-43	SMART
low complexity region	1264	1277	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114418
AA Change: D407G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110061
Gene: ENSMUSG00000036893
AA Change: D407G

Domain	Start	End	E-Value	Type
low complexity region	340	359	N/A	INTRINSIC
low complexity region	398	419	N/A	INTRINSIC
low complexity region	440	452	N/A	INTRINSIC
ANK	722	751	2.02e-5	SMART
ANK	755	786	3.06e-5	SMART
ANK	788	818	1.69e-7	SMART
ANK	822	851	6.65e-6	SMART
ANK	855	884	7.71e-2	SMART
ANK	888	917	6.12e-5	SMART
ANK	921	954	7.29e2	SMART
PreSET	961	1060	1.05e-30	SMART
SET	1076	1199	2.24e-43	SMART
low complexity region	1216	1229	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114432
AA Change: D400G

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110075
Gene: ENSMUSG00000036893
AA Change: D400G

Domain	Start	End	E-Value	Type
low complexity region	333	352	N/A	INTRINSIC
low complexity region	391	412	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
ANK	717	746	2.02e-5	SMART
ANK	750	781	3.06e-5	SMART
ANK	783	813	1.69e-7	SMART
ANK	817	846	6.65e-6	SMART
ANK	850	879	7.71e-2	SMART
ANK	883	912	6.12e-5	SMART
ANK	916	949	7.29e2	SMART
PreSET	956	1055	1.05e-30	SMART
SET	1071	1194	2.24e-43	SMART
low complexity region	1211	1224	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139000

Predicted Effect

probably benign
Transcript: ENSMUST00000147147
AA Change: D407G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000119057
Gene: ENSMUSG00000036893
AA Change: D407G

Domain	Start	End	E-Value	Type
low complexity region	252	271	N/A	INTRINSIC
low complexity region	310	331	N/A	INTRINSIC
low complexity region	352	364	N/A	INTRINSIC
ANK	634	663	2.02e-5	SMART
ANK	667	698	3.06e-5	SMART
ANK	700	730	1.69e-7	SMART
ANK	734	763	6.65e-6	SMART
ANK	767	796	7.71e-2	SMART
ANK	800	829	6.12e-5	SMART
ANK	833	866	7.29e2	SMART
PreSET	873	972	1.05e-30	SMART
SET	988	1111	2.24e-43	SMART
low complexity region	1128	1141	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000152325
AA Change: D155G

SMART Domains

Protein: ENSMUSP00000123387
Gene: ENSMUSG00000036893
AA Change: D155G

Domain	Start	End	E-Value	Type
low complexity region	89	108	N/A	INTRINSIC
low complexity region	147	168	N/A	INTRINSIC
low complexity region	189	201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200655

Predicted Effect

probably benign
Transcript: ENSMUST00000207383

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that is part of the E2F6 complex, which represses transcription. The encoded protein methylates the Lys-9 position of histone H3, which tags it for transcriptional repression. This protein may be involved in the silencing of MYC- and E2F-responsive genes and therefore could play a role in the G0/G1 cell cycle transition. Defects in this gene are a cause of chromosome 9q subtelomeric deletion syndrome (9q-syndrome, also known as Kleefstra syndrome). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Nullizygous embryos die circa E9.5 showing delayed growth and incomplete somite formation and neural groove closure. Heterozygotes show behavioral deficits and synaptic dysfunction. Homozygotes with a H3K9me1-binding mutant form show delayed prenatal growth and bone ossification and postnatal death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Ehmt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ehmt1	APN	2	24838818	missense	possibly damaging	0.81
IGL01403:Ehmt1	APN	2	24839626	missense	possibly damaging	0.81
IGL01636:Ehmt1	APN	2	24839608	missense	probably damaging	0.97
IGL01804:Ehmt1	APN	2	24791954	missense	probably damaging	1.00
IGL01836:Ehmt1	APN	2	24863220	splice site	probably null
IGL02740:Ehmt1	APN	2	24815839	splice site	probably benign
IGL02750:Ehmt1	APN	2	24863869	missense	probably damaging	1.00
IGL03026:Ehmt1	APN	2	24852734	missense	probably benign
IGL02799:Ehmt1	UTSW	2	24815806	missense	probably damaging	1.00
R0908:Ehmt1	UTSW	2	24804888	missense	probably damaging	1.00
R1275:Ehmt1	UTSW	2	24886995	critical splice donor site	probably null
R1665:Ehmt1	UTSW	2	24877464	missense	probably damaging	1.00
R1707:Ehmt1	UTSW	2	24805138	missense	probably benign
R1800:Ehmt1	UTSW	2	24884290	missense	probably damaging	0.99
R2108:Ehmt1	UTSW	2	24837618	missense	probably damaging	1.00
R2113:Ehmt1	UTSW	2	24804003	missense	probably damaging	1.00
R2393:Ehmt1	UTSW	2	24806217	missense	probably damaging	1.00
R2570:Ehmt1	UTSW	2	24815741	missense	probably damaging	1.00
R3923:Ehmt1	UTSW	2	24884335	splice site	probably null
R4646:Ehmt1	UTSW	2	24891684	missense	probably null	0.01
R4924:Ehmt1	UTSW	2	24839722	missense	probably damaging	0.97
R4989:Ehmt1	UTSW	2	24877497	missense	probably damaging	1.00
R5040:Ehmt1	UTSW	2	24884304	missense	probably benign	0.19
R5110:Ehmt1	UTSW	2	24852790	missense	probably benign	0.01
R5133:Ehmt1	UTSW	2	24877497	missense	probably damaging	1.00
R5134:Ehmt1	UTSW	2	24877497	missense	probably damaging	1.00
R5162:Ehmt1	UTSW	2	24877497	missense	probably damaging	1.00
R5183:Ehmt1	UTSW	2	24877497	missense	probably damaging	1.00
R5184:Ehmt1	UTSW	2	24877497	missense	probably damaging	1.00
R5208:Ehmt1	UTSW	2	24801533	missense	probably benign	0.34
R5309:Ehmt1	UTSW	2	24884195	missense	probably damaging	1.00
R5312:Ehmt1	UTSW	2	24884195	missense	probably damaging	1.00
R5837:Ehmt1	UTSW	2	24863914	missense	probably damaging	0.98
R5968:Ehmt1	UTSW	2	24836457	missense	probably damaging	0.99
R6539:Ehmt1	UTSW	2	24804767	missense	probably damaging	1.00
R6646:Ehmt1	UTSW	2	24806310	missense	probably damaging	0.99
R7065:Ehmt1	UTSW	2	24840697	missense	probably damaging	1.00
R7226:Ehmt1	UTSW	2	24804782	missense	probably damaging	1.00
R7361:Ehmt1	UTSW	2	24856701	missense	possibly damaging	0.94
R7373:Ehmt1	UTSW	2	24919573	start codon destroyed	probably null	0.03
R7410:Ehmt1	UTSW	2	24848068	missense	probably benign
R7418:Ehmt1	UTSW	2	24884634	missense	probably benign	0.02
R7633:Ehmt1	UTSW	2	24815780	missense	possibly damaging	0.68
R7716:Ehmt1	UTSW	2	24884499	missense	probably damaging	0.99
R7916:Ehmt1	UTSW	2	24856696	missense	probably damaging	1.00
R8112:Ehmt1	UTSW	2	24863384	missense	probably damaging	1.00
R8356:Ehmt1	UTSW	2	24852769	missense	probably benign
X0062:Ehmt1	UTSW	2	24863836	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGCTAACGGATCTCACAAG -3'
(R):5'- ACAGCTTGTTTCTACCTTGCGG -3'

Sequencing Primer
(F):5'- GCTAACGGATCTCACAAGGACATAAG -3'
(R):5'- TTTCTACCTTGCGGGCAGACAG -3'

Posted On

2016-06-21