Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Scn2a'

396979

Institutional Source

Beutler Lab

Gene Symbol

Scn2a

Ensembl Gene

ENSMUSG00000075318

Gene Name

sodium channel, voltage-gated, type II, alpha

Synonyms

A230052E19Rik, Scn2a1, Nav1.2

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65620771-65767447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65764591 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1928 (K1928R)

Ref Sequence

ENSEMBL: ENSMUSP00000143882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]

Predicted Effect

probably benign
Transcript: ENSMUST00000028377
AA Change: K1928R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: K1928R

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	2.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	9.6e-83	PFAM
Pfam:Ion_trans	759	994	3.6e-57	PFAM
Pfam:Na_trans_assoc	998	1204	1.7e-63	PFAM
Pfam:Ion_trans	1208	1484	3.3e-66	PFAM
Pfam:Ion_trans	1531	1788	2.8e-57	PFAM
Pfam:PKD_channel	1627	1782	8.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100067
AA Change: K1928R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: K1928R

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	157	424	3.3e-75	PFAM
low complexity region	433	448	N/A	INTRINSIC
low complexity region	450	471	N/A	INTRINSIC
Pfam:DUF3451	488	711	2.6e-66	PFAM
Pfam:Ion_trans	794	983	1.1e-47	PFAM
Pfam:Na_trans_assoc	998	1219	3.5e-77	PFAM
Pfam:Ion_trans	1245	1473	4.4e-55	PFAM
PDB:1BYY\|A	1475	1527	3e-31	PDB
Pfam:Ion_trans	1566	1776	2.4e-52	PFAM
Pfam:PKD_channel	1628	1783	3.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200829
AA Change: K1928R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: K1928R

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	1.2e-79	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	7.1e-80	PFAM
Pfam:Ion_trans	759	994	2.1e-55	PFAM
Pfam:Na_trans_assoc	998	1204	8e-61	PFAM
Pfam:Ion_trans	1208	1484	1.9e-64	PFAM
Pfam:Ion_trans	1531	1788	1.6e-55	PFAM
Pfam:PKD_channel	1627	1782	1.2e-4	PFAM
IQ	1905	1927	1.8e-5	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Meta Mutation Damage Score

0.0731

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Scn2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn2a	APN	2	65764440	missense	probably benign
IGL00159:Scn2a	APN	2	65743090	missense	probably damaging	1.00
IGL00418:Scn2a	APN	2	65764522	missense	probably benign	0.43
IGL00753:Scn2a	APN	2	65683863	missense	possibly damaging	0.66
IGL00770:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00774:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00847:Scn2a	APN	2	65670734	missense	probably damaging	1.00
IGL01155:Scn2a	APN	2	65717748	missense	probably damaging	1.00
IGL01329:Scn2a	APN	2	65717508	missense	probably benign	0.05
IGL01537:Scn2a	APN	2	65715875	missense	probably benign	0.00
IGL01672:Scn2a	APN	2	65751934	missense	probably damaging	1.00
IGL01958:Scn2a	APN	2	65701829	missense	probably damaging	1.00
IGL02028:Scn2a	APN	2	65763658	missense	probably damaging	0.96
IGL02142:Scn2a	APN	2	65715838	missense	probably damaging	1.00
IGL02160:Scn2a	APN	2	65730116	missense	probably damaging	1.00
IGL02183:Scn2a	APN	2	65671603	missense	probably benign	0.20
IGL02341:Scn2a	APN	2	65688377	missense	probably damaging	1.00
IGL02504:Scn2a	APN	2	65683884	missense	probably benign	0.02
IGL02530:Scn2a	APN	2	65730178	missense	probably damaging	0.99
IGL02621:Scn2a	APN	2	65748879	splice site	probably benign
IGL02652:Scn2a	APN	2	65702038	missense	possibly damaging	0.82
IGL02966:Scn2a	APN	2	65701844	missense	possibly damaging	0.93
IGL03188:Scn2a	APN	2	65671653	missense	probably damaging	0.99
IGL03329:Scn2a	APN	2	65764629	missense	probably benign
IGL03336:Scn2a	APN	2	65688744	missense	probably damaging	1.00
IGL03391:Scn2a	APN	2	65764213	missense	probably damaging	1.00
PIT4280001:Scn2a	UTSW	2	65715730	missense	probably damaging	1.00
PIT4362001:Scn2a	UTSW	2	65683838	missense	probably benign	0.09
PIT4403001:Scn2a	UTSW	2	65711908	missense	probably damaging	1.00
PIT4520001:Scn2a	UTSW	2	65688419	missense	probably damaging	1.00
R0021:Scn2a	UTSW	2	65670515	missense	possibly damaging	0.51
R0141:Scn2a	UTSW	2	65711816	missense	probably benign	0.01
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0335:Scn2a	UTSW	2	65682091	missense	probably damaging	1.00
R0508:Scn2a	UTSW	2	65717842	missense	probably damaging	0.99
R0558:Scn2a	UTSW	2	65711925	missense	probably benign	0.26
R0600:Scn2a	UTSW	2	65701833	missense	possibly damaging	0.90
R0667:Scn2a	UTSW	2	65751996	missense	possibly damaging	0.91
R1178:Scn2a	UTSW	2	65686779	splice site	probably benign
R1244:Scn2a	UTSW	2	65763655	missense	probably damaging	0.98
R1386:Scn2a	UTSW	2	65688741	missense	probably damaging	1.00
R1434:Scn2a	UTSW	2	65701991	missense	possibly damaging	0.79
R1440:Scn2a	UTSW	2	65764594	missense	probably benign
R1448:Scn2a	UTSW	2	65683845	missense	probably benign	0.17
R1460:Scn2a	UTSW	2	65701843	missense	probably damaging	0.96
R1553:Scn2a	UTSW	2	65713836	nonsense	probably null
R1642:Scn2a	UTSW	2	65683697	missense	probably damaging	1.00
R1803:Scn2a	UTSW	2	65670767	splice site	probably null
R1981:Scn2a	UTSW	2	65690170	missense	probably damaging	1.00
R2002:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R2068:Scn2a	UTSW	2	65752073	missense	probably benign	0.14
R2125:Scn2a	UTSW	2	65752079	nonsense	probably null
R2126:Scn2a	UTSW	2	65752079	nonsense	probably null
R2876:Scn2a	UTSW	2	65715897	missense	possibly damaging	0.64
R2878:Scn2a	UTSW	2	65688371	missense	probably damaging	1.00
R3113:Scn2a	UTSW	2	65748785	missense	possibly damaging	0.86
R3749:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3750:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3765:Scn2a	UTSW	2	65682710	missense	possibly damaging	0.51
R3850:Scn2a	UTSW	2	65682031	missense	probably benign	0.14
R4585:Scn2a	UTSW	2	65743051	splice site	probably null
R4586:Scn2a	UTSW	2	65743051	splice site	probably null
R4588:Scn2a	UTSW	2	65713767	missense	possibly damaging	0.76
R4622:Scn2a	UTSW	2	65752027	missense	probably benign	0.04
R5108:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R5235:Scn2a	UTSW	2	65752011	missense	probably damaging	1.00
R5464:Scn2a	UTSW	2	65701756	missense	probably damaging	1.00
R5586:Scn2a	UTSW	2	65707295	nonsense	probably null
R5630:Scn2a	UTSW	2	65726365	missense	probably damaging	1.00
R5715:Scn2a	UTSW	2	65717584	missense	probably benign	0.27
R5730:Scn2a	UTSW	2	65682538	nonsense	probably null
R5734:Scn2a	UTSW	2	65717722	missense	possibly damaging	0.49
R5779:Scn2a	UTSW	2	65764483	missense	probably benign	0.00
R6133:Scn2a	UTSW	2	65743104	missense	probably benign	0.35
R6547:Scn2a	UTSW	2	65715897	missense	probably benign	0.29
R6549:Scn2a	UTSW	2	65764674	missense	probably benign	0.05
R6818:Scn2a	UTSW	2	65688669	nonsense	probably null
R6999:Scn2a	UTSW	2	65682109	missense	probably benign
R7069:Scn2a	UTSW	2	65764606	missense	probably benign	0.00
R7073:Scn2a	UTSW	2	65728443	missense	probably benign	0.00
R7125:Scn2a	UTSW	2	65763933	missense	probably damaging	1.00
R7178:Scn2a	UTSW	2	65748853	nonsense	probably null
R7179:Scn2a	UTSW	2	65701979	missense	probably damaging	1.00
R7203:Scn2a	UTSW	2	65748319	missense	probably benign	0.01
R7227:Scn2a	UTSW	2	65752023	missense	probably damaging	0.98
R7269:Scn2a	UTSW	2	65763769	missense	probably damaging	1.00
R7358:Scn2a	UTSW	2	65682506	nonsense	probably null
R7388:Scn2a	UTSW	2	65688654	missense	probably damaging	1.00
R7491:Scn2a	UTSW	2	65702008	missense	probably damaging	0.99
R7619:Scn2a	UTSW	2	65715903	missense	probably damaging	1.00
R7695:Scn2a	UTSW	2	65711907	missense	probably damaging	0.99
R7735:Scn2a	UTSW	2	65763669	missense	probably benign	0.40
R7911:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R8096:Scn2a	UTSW	2	65764022	missense	probably damaging	0.98
R8333:Scn2a	UTSW	2	65683847	missense	probably benign	0.01
R8416:Scn2a	UTSW	2	65681001	missense	probably benign	0.00
Z1176:Scn2a	UTSW	2	65751868	missense	possibly damaging	0.84
Z1177:Scn2a	UTSW	2	65717735	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TTTACAAAGCGGGTCCTGGG -3'
(R):5'- ACAGGCTGTAAACAGTTGATCAC -3'

Sequencing Primer
(F):5'- TCCTGGGTGAGAGTGGAGAGATG -3'
(R):5'- GGCTGTAAACAGTTGATCACAAAATG -3'

Posted On

2016-06-21