Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Ttc21b'

396980

Institutional Source

Beutler Lab

Gene Symbol

Ttc21b

Ensembl Gene

ENSMUSG00000034848

Gene Name

tetratricopeptide repeat domain 21B

Synonyms

line 158, Thm1, aln, 2410066K11Rik

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66184327-66256617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66229023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 545 (C545R)

Ref Sequence

ENSEMBL: ENSMUSP00000131758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102718] [ENSMUST00000125446]

AlphaFold

Q0HA38

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102718
AA Change: C545R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099779
Gene: ENSMUSG00000034848
AA Change: C545R

Domain	Start	End	E-Value	Type
Blast:TPR	109	141	5e-12	BLAST
Blast:TPR	178	211	3e-12	BLAST
TPR	324	357	4.21e1	SMART
low complexity region	379	390	N/A	INTRINSIC
TPR	492	525	8.51e0	SMART
TPR	526	559	5.92e1	SMART
TPR	563	596	7.69e1	SMART
TPR	721	754	3.07e-5	SMART
TPR	755	788	9.45e0	SMART
TPR	790	821	9.24e1	SMART
TPR	830	863	3.05e0	SMART
TPR	883	916	1.55e-1	SMART
TPR	917	950	8.74e0	SMART
TPR	951	984	6.75e1	SMART
Blast:TPR	1023	1054	5e-13	BLAST
Blast:TPR	1156	1189	1e-12	BLAST
TPR	1196	1229	9.7e0	SMART
TPR	1265	1298	1.02e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125446
AA Change: C545R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131758
Gene: ENSMUSG00000034848
AA Change: C545R

Domain	Start	End	E-Value	Type
Blast:TPR	108	141	3e-12	BLAST
Blast:TPR	178	211	3e-12	BLAST
TPR	324	357	4.21e1	SMART
low complexity region	379	390	N/A	INTRINSIC
TPR	492	525	8.51e0	SMART
TPR	526	559	5.92e1	SMART
TPR	563	596	7.69e1	SMART
TPR	721	754	3.07e-5	SMART
TPR	755	788	9.45e0	SMART
TPR	790	821	9.24e1	SMART
TPR	830	863	3.05e0	SMART
TPR	883	916	1.55e-1	SMART
TPR	917	950	8.74e0	SMART
TPR	951	984	6.75e1	SMART
Blast:TPR	1023	1054	4e-13	BLAST
Blast:TPR	1156	1189	9e-13	BLAST
TPR	1196	1229	9.7e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131503

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169968

Meta Mutation Damage Score

0.8522

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. Mutant embryos exhibit several deformities including polydactyly, microphthalmia, irregular shape of the long bones, rib fusion and truncation, neural tube defects, and abnormal brain structure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Ttc21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Ttc21b	APN	2	66242775	missense	probably benign	0.00
IGL00467:Ttc21b	APN	2	66188364	missense	probably damaging	1.00
IGL00721:Ttc21b	APN	2	66226778	missense	probably benign	0.06
IGL00837:Ttc21b	APN	2	66235571	critical splice donor site	probably null
IGL01317:Ttc21b	APN	2	66188356	missense	probably benign	0.00
IGL01485:Ttc21b	APN	2	66251890	splice site	probably benign
IGL01739:Ttc21b	APN	2	66237856	missense	probably benign
IGL02282:Ttc21b	APN	2	66191737	missense	probably damaging	0.96
IGL02431:Ttc21b	APN	2	66251885	splice site	probably benign
IGL02478:Ttc21b	APN	2	66188280	missense	probably benign	0.05
IGL02487:Ttc21b	APN	2	66235156	missense	probably benign	0.02
IGL03327:Ttc21b	APN	2	66237848	missense	possibly damaging	0.92
IGL03346:Ttc21b	APN	2	66237848	missense	possibly damaging	0.92
plus-sized	UTSW	2	66242679	missense	probably damaging	1.00
R6482_Ttc21b_149	UTSW	2	66226900	missense	probably benign	0.12
PIT4696001:Ttc21b	UTSW	2	66231219	splice site	probably null
R0049:Ttc21b	UTSW	2	66223564	missense	probably damaging	1.00
R0049:Ttc21b	UTSW	2	66223564	missense	probably damaging	1.00
R0373:Ttc21b	UTSW	2	66188326	missense	probably damaging	0.99
R0440:Ttc21b	UTSW	2	66236382	missense	probably benign	0.03
R0504:Ttc21b	UTSW	2	66222798	splice site	probably benign
R0600:Ttc21b	UTSW	2	66239570	missense	probably damaging	0.99
R0621:Ttc21b	UTSW	2	66226011	missense	probably benign	0.07
R0633:Ttc21b	UTSW	2	66236233	missense	probably benign
R0863:Ttc21b	UTSW	2	66242773	missense	probably benign
R1617:Ttc21b	UTSW	2	66226035	missense	probably benign	0.22
R1837:Ttc21b	UTSW	2	66197762	missense	probably benign	0.01
R1844:Ttc21b	UTSW	2	66223577	nonsense	probably null
R2120:Ttc21b	UTSW	2	66226754	missense	probably benign	0.12
R2205:Ttc21b	UTSW	2	66235123	missense	possibly damaging	0.51
R2392:Ttc21b	UTSW	2	66207450	critical splice donor site	probably null
R3689:Ttc21b	UTSW	2	66224144	missense	probably benign	0.22
R3810:Ttc21b	UTSW	2	66252233	critical splice acceptor site	probably null
R3847:Ttc21b	UTSW	2	66242679	missense	probably damaging	1.00
R3897:Ttc21b	UTSW	2	66235069	missense	probably benign	0.01
R4561:Ttc21b	UTSW	2	66186218	missense	probably damaging	1.00
R4671:Ttc21b	UTSW	2	66226913	missense	possibly damaging	0.66
R5274:Ttc21b	UTSW	2	66236283	missense	possibly damaging	0.89
R5594:Ttc21b	UTSW	2	66236235	missense	probably benign	0.39
R6210:Ttc21b	UTSW	2	66236354	missense	probably benign	0.00
R6305:Ttc21b	UTSW	2	66188270	missense	probably damaging	0.99
R6456:Ttc21b	UTSW	2	66188331	missense	probably damaging	0.97
R6482:Ttc21b	UTSW	2	66226900	missense	probably benign	0.12
R6645:Ttc21b	UTSW	2	66236377	missense	probably benign	0.01
R6800:Ttc21b	UTSW	2	66208650	splice site	probably null
R6815:Ttc21b	UTSW	2	66226790	missense	probably benign	0.00
R6959:Ttc21b	UTSW	2	66231312	missense	probably benign	0.05
R7125:Ttc21b	UTSW	2	66236326	missense	probably benign	0.00
R7265:Ttc21b	UTSW	2	66210173	missense	possibly damaging	0.89
R7283:Ttc21b	UTSW	2	66208718	missense	probably damaging	0.96
R7560:Ttc21b	UTSW	2	66217204	missense	possibly damaging	0.69
R7561:Ttc21b	UTSW	2	66217204	missense	possibly damaging	0.69
R7816:Ttc21b	UTSW	2	66247361	missense	possibly damaging	0.82
R8172:Ttc21b	UTSW	2	66252156	missense	probably benign	0.01
R8179:Ttc21b	UTSW	2	66201480	missense	probably benign
R9047:Ttc21b	UTSW	2	66201252	missense
R9282:Ttc21b	UTSW	2	66226005	missense	possibly damaging	0.65
R9336:Ttc21b	UTSW	2	66226943	missense	probably benign
X0013:Ttc21b	UTSW	2	66225950	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTCTGCCCATGAAATTCG -3'
(R):5'- TAGGAATGGAGGCCAGGTTC -3'

Sequencing Primer
(F):5'- GCCCATGAAATTCGACATTGTGG -3'
(R):5'- TTCACGGACAGAGACGTTAAAC -3'

Posted On

2016-06-21