Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Pde1a'

396981

Institutional Source

Beutler Lab

Gene Symbol

Pde1a

Ensembl Gene

ENSMUSG00000059173

Gene Name

phosphodiesterase 1A, calmodulin-dependent

Synonyms

MMRRC Submission

042743-MU

Accession Numbers

Genbank: NM_001159582, NM_016744, NM_001009978, NM_001009979

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79834453-80129458 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79878144 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 242 (N242S)

Ref Sequence

ENSEMBL: ENSMUSP00000099711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090756] [ENSMUST00000102651] [ENSMUST00000102652] [ENSMUST00000102653] [ENSMUST00000102654] [ENSMUST00000102655] [ENSMUST00000183775]

Predicted Effect

probably null
Transcript: ENSMUST00000090756
AA Change: N206S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000088260
Gene: ENSMUSG00000059173
AA Change: N206S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	1	29	3.4e-11	PFAM
HDc	112	276	5.19e-7	SMART
low complexity region	344	357	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102651
AA Change: N242S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099711
Gene: ENSMUSG00000059173
AA Change: N242S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	5	65	9.3e-32	PFAM
HDc	148	312	5.19e-7	SMART
low complexity region	380	393	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102652
AA Change: N242S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099712
Gene: ENSMUSG00000059173
AA Change: N242S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	5	65	9e-32	PFAM
HDc	148	312	5.19e-7	SMART
low complexity region	380	393	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102653
AA Change: N310S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099713
Gene: ENSMUSG00000059173
AA Change: N310S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	73	133	1.2e-31	PFAM
HDc	216	380	5.19e-7	SMART
low complexity region	448	461	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102654
AA Change: N310S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099714
Gene: ENSMUSG00000059173
AA Change: N310S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	73	133	1.2e-31	PFAM
HDc	216	380	5.19e-7	SMART
low complexity region	448	461	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102655
AA Change: N310S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099715
Gene: ENSMUSG00000059173
AA Change: N310S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	73	133	7.8e-35	PFAM
HDc	216	380	5.19e-7	SMART
low complexity region	448	461	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000134739
AA Change: N277S

SMART Domains

Protein: ENSMUSP00000120188
Gene: ENSMUSG00000059173
AA Change: N277S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	41	101	1.4e-35	PFAM
HDc	184	348	5.19e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000134739
AA Change: N277S

SMART Domains

Protein: ENSMUSP00000120188
Gene: ENSMUSG00000059173
AA Change: N277S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	41	101	1.4e-35	PFAM
HDc	184	348	5.19e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000183775
AA Change: N310S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139327
Gene: ENSMUSG00000059173
AA Change: N310S

Domain	Start	End	E-Value	Type
Pfam:PDEase_I_N	73	133	1.2e-31	PFAM
HDc	216	380	5.19e-7	SMART
low complexity region	448	461	N/A	INTRINSIC

Meta Mutation Damage Score

0.5484

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclic nucleotide phosphodiesterases (PDEs) play a role in signal transduction by regulating intracellular cyclic nucleotide concentrations through hydrolysis of cAMP and/or cGMP to their respective nucleoside 5-prime monophosphates. Members of the PDE1 family, such as PDE1A, are Ca(2+)/calmodulin (see CALM1; MIM 114180)-dependent PDEs (CaM-PDEs) that are activated by calmodulin in the presence of Ca(2+) (Michibata et al., 2001 [PubMed 11342109]; Fidock et al., 2002 [PubMed 11747989]).[supplied by OMIM, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Pde1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Pde1a	APN	2	79865670	missense	probably damaging	1.00
IGL01860:Pde1a	APN	2	79875284	missense	probably damaging	1.00
IGL02059:Pde1a	APN	2	79897077	missense	possibly damaging	0.64
IGL02307:Pde1a	APN	2	79906068	missense	possibly damaging	0.70
IGL02376:Pde1a	APN	2	79875223	splice site	probably benign
IGL02569:Pde1a	APN	2	79868258	missense	probably benign	0.04
IGL03038:Pde1a	APN	2	79887946	splice site	probably benign
G5030:Pde1a	UTSW	2	79887836	splice site	probably benign
R0099:Pde1a	UTSW	2	79868313	critical splice acceptor site	probably null
R0549:Pde1a	UTSW	2	79865070	missense	probably damaging	1.00
R0960:Pde1a	UTSW	2	79865034	splice site	probably benign
R1855:Pde1a	UTSW	2	79898064	critical splice donor site	probably null
R1907:Pde1a	UTSW	2	79868307	missense	probably damaging	1.00
R1972:Pde1a	UTSW	2	79865721	missense	probably damaging	0.99
R2262:Pde1a	UTSW	2	80128931	start gained	probably benign
R4658:Pde1a	UTSW	2	79898181	critical splice acceptor site	probably benign
R4674:Pde1a	UTSW	2	79898181	critical splice acceptor site	probably benign
R4842:Pde1a	UTSW	2	80128837	utr 5 prime	probably benign
R4878:Pde1a	UTSW	2	79878139	missense	probably benign	0.05
R5473:Pde1a	UTSW	2	79906028	missense	probably damaging	1.00
R5940:Pde1a	UTSW	2	79887839	critical splice donor site	probably null
R5976:Pde1a	UTSW	2	79868242	nonsense	probably null
R6016:Pde1a	UTSW	2	79865062	missense	probably benign	0.01
R6242:Pde1a	UTSW	2	80128792	missense	probably benign
R6248:Pde1a	UTSW	2	79878201	missense	probably damaging	1.00
R6609:Pde1a	UTSW	2	79906140	missense	probably damaging	1.00
R6858:Pde1a	UTSW	2	80129158	unclassified	probably benign
R7161:Pde1a	UTSW	2	79865214	missense	probably benign	0.00
X0025:Pde1a	UTSW	2	79838930	makesense	probably null
Z1176:Pde1a	UTSW	2	79906028	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTTTACACATGTGCTAGGG -3'
(R):5'- GTGTGATGACTACTTACTATGGAAACC -3'

Sequencing Primer
(F):5'- AGTTTCTGTCTATCCAGCAGCAGAG -3'
(R):5'- CTATGGAAACCTCAAAGTCTGAAG -3'

Posted On

2016-06-21