Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Itpripl1'

396982

Institutional Source

Beutler Lab

Gene Symbol

Itpripl1

Ensembl Gene

ENSMUSG00000074825

Gene Name

inositol 1,4,5-triphosphate receptor interacting protein-like 1

Synonyms

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127138772-127143442 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 127141857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 115 (L115R)

Ref Sequence

ENSEMBL: ENSMUSP00000122289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110386] [ENSMUST00000132773] [ENSMUST00000154021]

AlphaFold

A2ASA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000110386
AA Change: L115R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106016
Gene: ENSMUSG00000074825
AA Change: L115R

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
coiled coil region	32	66	N/A	INTRINSIC
low complexity region	131	140	N/A	INTRINSIC
Mab-21	214	533	1.66e-66	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132773

SMART Domains

Protein: ENSMUSP00000118487
Gene: ENSMUSG00000074825

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
coiled coil region	32	66	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000154021
AA Change: L115R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122289
Gene: ENSMUSG00000074825
AA Change: L115R

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
coiled coil region	32	66	N/A	INTRINSIC
low complexity region	131	140	N/A	INTRINSIC
Mab-21	214	533	1.66e-66	SMART

Meta Mutation Damage Score

0.8475

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Itpripl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02444:Itpripl1	APN	2	127141701	missense	possibly damaging	0.87
IGL02978:Itpripl1	APN	2	127141012	missense	probably damaging	1.00
R0328:Itpripl1	UTSW	2	127142004	missense	possibly damaging	0.94
R0579:Itpripl1	UTSW	2	127141091	nonsense	probably null
R1178:Itpripl1	UTSW	2	127141899	missense	probably benign	0.05
R1623:Itpripl1	UTSW	2	127141635	missense	possibly damaging	0.78
R1956:Itpripl1	UTSW	2	127142007	missense	probably damaging	0.98
R2877:Itpripl1	UTSW	2	127141614	missense	probably benign	0.00
R2878:Itpripl1	UTSW	2	127141614	missense	probably benign	0.00
R4949:Itpripl1	UTSW	2	127141407	missense	probably benign	0.13
R5236:Itpripl1	UTSW	2	127141850	missense	probably damaging	1.00
R5364:Itpripl1	UTSW	2	127141819	missense	possibly damaging	0.60
R5637:Itpripl1	UTSW	2	127142124	missense	probably damaging	1.00
R5715:Itpripl1	UTSW	2	127142007	missense	probably damaging	0.98
R7545:Itpripl1	UTSW	2	127141661	nonsense	probably null
R8409:Itpripl1	UTSW	2	127140766	missense	probably benign	0.44
R8708:Itpripl1	UTSW	2	127141342	missense	probably benign
R9321:Itpripl1	UTSW	2	127142080	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGGTCACGGATGGCATTTTG -3'
(R):5'- GCCTCATGTTCTTGGCAGTG -3'

Sequencing Primer
(F):5'- CACGGATGGCATTTTGGATATAATG -3'
(R):5'- GCAGTGATGTATGTTGTTCACCACC -3'

Posted On

2016-06-21