Incidental Mutation 'R5161:Ddrgk1'
ID396983
Institutional Source Beutler Lab
Gene Symbol Ddrgk1
Ensembl Gene ENSMUSG00000068290
Gene NameDDRGK domain containing 1
Synonyms
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130653960-130664659 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 130663376 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000121190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089559] [ENSMUST00000103193] [ENSMUST00000135072]
Predicted Effect probably benign
Transcript: ENSMUST00000089559
AA Change: D90E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000086988
Gene: ENSMUSG00000068290
AA Change: D90E

DomainStartEndE-ValueType
transmembrane domain 4 21 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
DDRGK 116 304 8.35e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103193
SMART Domains Protein: ENSMUSP00000099482
Gene: ENSMUSG00000074797

DomainStartEndE-ValueType
Pfam:Ham1p_like 10 188 4.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133328
Predicted Effect probably benign
Transcript: ENSMUST00000134044
SMART Domains Protein: ENSMUSP00000114535
Gene: ENSMUSG00000068290

DomainStartEndE-ValueType
Pfam:DDRGK 1 54 4.9e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135072
AA Change: M1K
SMART Domains Protein: ENSMUSP00000121190
Gene: ENSMUSG00000068290
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
coiled coil region 20 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156382
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with components of the ubiquitin fold modifier 1 conjugation pathway and helps prevent apoptosis in ER-stressed secretory tissues. In addition, the encoded protein regulates nuclear factor-κB activity. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality by E13.5 with impaired embryonic erythropoiesis. Embryos show delayed limb bud condrogenic condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Ddrgk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Ddrgk1 APN 2 130658294 unclassified probably benign
IGL01654:Ddrgk1 APN 2 130654709 missense probably damaging 1.00
IGL01977:Ddrgk1 APN 2 130655246 unclassified probably benign
IGL02465:Ddrgk1 APN 2 130654709 missense probably damaging 1.00
R1864:Ddrgk1 UTSW 2 130654295 missense probably damaging 1.00
R1865:Ddrgk1 UTSW 2 130654295 missense probably damaging 1.00
R1935:Ddrgk1 UTSW 2 130663560 splice site probably benign
R1940:Ddrgk1 UTSW 2 130663560 splice site probably benign
R2871:Ddrgk1 UTSW 2 130664644 unclassified probably benign
R4787:Ddrgk1 UTSW 2 130658328 missense probably damaging 0.97
R6140:Ddrgk1 UTSW 2 130658614 missense probably benign 0.20
R6184:Ddrgk1 UTSW 2 130664561 missense possibly damaging 0.95
R6238:Ddrgk1 UTSW 2 130654679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTGACTTCAAGGACCAAAGC -3'
(R):5'- CTTGAAGATGGGCTGCTTGAC -3'

Sequencing Primer
(F):5'- TTCAAGGACCAAAGCCCAGG -3'
(R):5'- CTGCTTGACAGTGTTATGATTCC -3'
Posted On2016-06-21