Incidental Mutation 'R5161:Hyal5'
ID396989
Institutional Source Beutler Lab
Gene Symbol Hyal5
Ensembl Gene ENSMUSG00000029678
Gene Namehyaluronoglucosaminidase 5
Synonyms
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24857997-24891958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24891603 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 472 (D472V)
Ref Sequence ENSEMBL: ENSMUSP00000144011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031689] [ENSMUST00000200968]
Predicted Effect probably benign
Transcript: ENSMUST00000031689
AA Change: D472V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031689
Gene: ENSMUSG00000029678
AA Change: D472V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104008
Predicted Effect probably benign
Transcript: ENSMUST00000200968
AA Change: D472V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144011
Gene: ENSMUSG00000029678
AA Change: D472V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201585
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Reproduction is normal in mice with null mutations at this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Hyal5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Hyal5 APN 6 24876481 missense possibly damaging 0.92
IGL01407:Hyal5 APN 6 24876407 missense probably benign 0.08
IGL01799:Hyal5 APN 6 24891337 missense probably benign 0.09
IGL02070:Hyal5 APN 6 24876962 missense probably damaging 1.00
IGL02087:Hyal5 APN 6 24876725 missense probably damaging 1.00
IGL02188:Hyal5 APN 6 24877036 missense probably damaging 1.00
IGL02321:Hyal5 APN 6 24891615 missense probably benign 0.01
IGL02975:Hyal5 APN 6 24891452 missense probably benign 0.41
IGL03299:Hyal5 APN 6 24877882 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0499:Hyal5 UTSW 6 24877921 missense probably damaging 1.00
R1491:Hyal5 UTSW 6 24877903 missense probably benign 0.00
R1575:Hyal5 UTSW 6 24876793 missense probably damaging 1.00
R1967:Hyal5 UTSW 6 24876194 missense possibly damaging 0.68
R2182:Hyal5 UTSW 6 24877880 missense probably damaging 1.00
R3801:Hyal5 UTSW 6 24876524 missense probably benign 0.44
R3877:Hyal5 UTSW 6 24876631 missense probably damaging 1.00
R4642:Hyal5 UTSW 6 24876622 missense probably benign 0.01
R4826:Hyal5 UTSW 6 24891576 missense possibly damaging 0.82
R5058:Hyal5 UTSW 6 24891485 missense probably damaging 1.00
R5249:Hyal5 UTSW 6 24876649 nonsense probably null
R5459:Hyal5 UTSW 6 24891251 missense probably damaging 0.98
R5685:Hyal5 UTSW 6 24876692 missense probably benign 0.39
R5741:Hyal5 UTSW 6 24876495 missense probably damaging 1.00
R5849:Hyal5 UTSW 6 24891556 missense probably benign 0.00
R6156:Hyal5 UTSW 6 24891438 missense possibly damaging 0.92
R6351:Hyal5 UTSW 6 24891709 unclassified probably null
R6573:Hyal5 UTSW 6 24891552 missense probably damaging 0.96
R6949:Hyal5 UTSW 6 24876304 missense probably benign 0.00
R6966:Hyal5 UTSW 6 24891292 missense probably damaging 1.00
R7148:Hyal5 UTSW 6 24876902 missense probably damaging 1.00
R7422:Hyal5 UTSW 6 24875984 start gained probably benign
R7836:Hyal5 UTSW 6 24891348 missense probably damaging 1.00
R7919:Hyal5 UTSW 6 24891348 missense probably damaging 1.00
R8062:Hyal5 UTSW 6 24876197 missense possibly damaging 0.73
X0061:Hyal5 UTSW 6 24876973 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGAAATCCGTGGCAATCCC -3'
(R):5'- CCCTGAAAGTATGACAGCCTTAC -3'

Sequencing Primer
(F):5'- TGGCAATCCCACCCTTGAG -3'
(R):5'- GAAAGTATGACAGCCTTACAATCAG -3'
Posted On2016-06-21