Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Olfr305'

396993

Institutional Source

Beutler Lab

Gene Symbol

Olfr305

Ensembl Gene

ENSMUSG00000055571

Gene Name

olfactory receptor 305

Synonyms

MOR219-2, GA_x6K02T2NHDJ-9744055-9745014

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86360854-86366928 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 86364338 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000068650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069236] [ENSMUST00000213255] [ENSMUST00000213869] [ENSMUST00000216700]

AlphaFold

Q7TS02

Predicted Effect

probably null
Transcript: ENSMUST00000069236

SMART Domains

Protein: ENSMUSP00000068650
Gene: ENSMUSG00000055571

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	2.3e-40	PFAM
Pfam:7tm_1	39	288	3.3e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213255

Predicted Effect

probably benign
Transcript: ENSMUST00000213869

Predicted Effect

probably benign
Transcript: ENSMUST00000216700

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Olfr305

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Olfr305	APN	7	86363560	missense	possibly damaging	0.46
IGL02102:Olfr305	APN	7	86363866	missense	probably benign	0.25
IGL02424:Olfr305	APN	7	86363480	missense	probably benign	0.02
IGL02664:Olfr305	APN	7	86363603	missense	possibly damaging	0.94
IGL03167:Olfr305	APN	7	86363920	missense	probably damaging	1.00
R0035:Olfr305	UTSW	7	86364187	missense	possibly damaging	0.95
R0373:Olfr305	UTSW	7	86363805	nonsense	probably null
R0510:Olfr305	UTSW	7	86363827	missense	probably benign	0.21
R2214:Olfr305	UTSW	7	86364206	missense	probably benign	0.01
R3147:Olfr305	UTSW	7	86363884	missense	probably benign	0.01
R3623:Olfr305	UTSW	7	86364100	missense	probably benign	0.02
R4155:Olfr305	UTSW	7	86364062	missense	probably benign	0.00
R4332:Olfr305	UTSW	7	86363872	missense	probably benign	0.01
R4785:Olfr305	UTSW	7	86363735	missense	probably damaging	1.00
R4834:Olfr305	UTSW	7	86363744	missense	probably benign	0.21
R4871:Olfr305	UTSW	7	86363484	missense	probably damaging	1.00
R5254:Olfr305	UTSW	7	86364190	missense	possibly damaging	0.82
R6430:Olfr305	UTSW	7	86363973	nonsense	probably null
R7734:Olfr305	UTSW	7	86364268	missense	not run
R8520:Olfr305	UTSW	7	86364263	missense	probably benign	0.00
R8682:Olfr305	UTSW	7	86364165	missense	probably damaging	0.99
R9407:Olfr305	UTSW	7	86363986	nonsense	probably null
RF010:Olfr305	UTSW	7	86363386	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCAAGAAGAAGTACATGGGTGTTTG -3'
(R):5'- TGCAGAAAACGTGCTTAGCTG -3'

Sequencing Primer
(F):5'- TACATGGGTGTTTGGAGCTTCAGATC -3'
(R):5'- CGTGCTTAGCTGCTTAACAAG -3'

Posted On

2016-06-21