Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Dock1'

396996

Institutional Source

Beutler Lab

Gene Symbol

Dock1

Ensembl Gene

ENSMUSG00000058325

Gene Name

dedicator of cytokinesis 1

Synonyms

D630004B07Rik, Dock180, 9130006G06Rik

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134670654-135173639 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 134734062 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 62 (A62T)

Ref Sequence

ENSEMBL: ENSMUSP00000081531 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084488] [ENSMUST00000211593]

PDB Structure

Solution structure of the SH3 domain of DOCK180 [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084488
AA Change: A62T

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: A62T

Domain	Start	End	E-Value	Type
SH3	12	69	7.57e-17	SMART
Pfam:DOCK_N	72	416	1.7e-113	PFAM
Pfam:DOCK-C2	421	618	1.2e-61	PFAM
low complexity region	628	639	N/A	INTRINSIC
Pfam:DHR-2	1111	1610	3.3e-102	PFAM
low complexity region	1639	1664	N/A	INTRINSIC
low complexity region	1683	1701	N/A	INTRINSIC
low complexity region	1756	1773	N/A	INTRINSIC
low complexity region	1823	1857	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211570

Predicted Effect

probably benign
Transcript: ENSMUST00000211593
AA Change: A62T

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0767

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Dock1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Dock1	APN	7	135146531	splice site	probably benign
IGL01319:Dock1	APN	7	134789278	missense	probably benign
IGL01390:Dock1	APN	7	134745047	missense	possibly damaging	0.95
IGL01394:Dock1	APN	7	134766216	missense	probably benign	0.01
IGL01489:Dock1	APN	7	134999321	splice site	probably benign
IGL01505:Dock1	APN	7	135158510	missense	possibly damaging	0.91
IGL01586:Dock1	APN	7	134753377	missense	probably damaging	1.00
IGL01637:Dock1	APN	7	135137813	critical splice acceptor site	probably null
IGL01649:Dock1	APN	7	134777410	missense	probably damaging	1.00
IGL01652:Dock1	APN	7	134777497	splice site	probably benign
IGL01859:Dock1	APN	7	135077161	missense	possibly damaging	0.51
IGL02068:Dock1	APN	7	134771548	missense	probably benign	0.26
IGL02168:Dock1	APN	7	135077131	splice site	probably benign
IGL02200:Dock1	APN	7	134744271	missense	probably benign	0.01
IGL02244:Dock1	APN	7	134777445	nonsense	probably null
IGL02285:Dock1	APN	7	135081920	critical splice donor site	probably null
IGL02319:Dock1	APN	7	134772449	missense	possibly damaging	0.94
IGL02334:Dock1	APN	7	135145565	missense	probably damaging	1.00
IGL02338:Dock1	APN	7	135133075	missense	possibly damaging	0.95
IGL02351:Dock1	APN	7	135108819	missense	possibly damaging	0.51
IGL02358:Dock1	APN	7	135108819	missense	possibly damaging	0.51
IGL02607:Dock1	APN	7	134851513	missense	probably benign	0.13
IGL02638:Dock1	APN	7	135146480	missense	probably benign	0.09
IGL02724:Dock1	APN	7	135163353	missense	probably benign
IGL02820:Dock1	APN	7	135167215	missense	probably benign	0.11
IGL02950:Dock1	APN	7	134730024	missense	probably damaging	1.00
IGL02993:Dock1	APN	7	134744298	missense	probably benign
IGL03000:Dock1	APN	7	134789240	missense	probably benign	0.17
IGL03092:Dock1	APN	7	134765216	splice site	probably benign
IGL03131:Dock1	APN	7	134874183	missense	possibly damaging	0.80
IGL03136:Dock1	APN	7	135168389	missense	probably benign	0.00
IGL03210:Dock1	APN	7	134756939	missense	possibly damaging	0.62
IGL03220:Dock1	APN	7	135108522	critical splice donor site	probably null
P0028:Dock1	UTSW	7	134999324	splice site	probably benign
PIT4453001:Dock1	UTSW	7	135152300	missense	probably benign
R0003:Dock1	UTSW	7	134730064	splice site	probably benign
R0058:Dock1	UTSW	7	135108761	missense	possibly damaging	0.65
R0058:Dock1	UTSW	7	135108761	missense	possibly damaging	0.65
R0062:Dock1	UTSW	7	134777495	splice site	probably null
R0062:Dock1	UTSW	7	134777495	splice site	probably null
R0179:Dock1	UTSW	7	135098837	missense	probably damaging	0.99
R0180:Dock1	UTSW	7	135098837	missense	probably damaging	0.99
R0347:Dock1	UTSW	7	134763867	missense	probably damaging	1.00
R0399:Dock1	UTSW	7	135163442	missense	probably benign	0.00
R0457:Dock1	UTSW	7	135138145	missense	possibly damaging	0.90
R0480:Dock1	UTSW	7	134737718	missense	probably damaging	1.00
R0521:Dock1	UTSW	7	135143778	missense	probably benign	0.21
R0792:Dock1	UTSW	7	134874150	missense	probably benign	0.02
R1136:Dock1	UTSW	7	134848173	missense	possibly damaging	0.95
R1224:Dock1	UTSW	7	135108819	missense	possibly damaging	0.67
R1267:Dock1	UTSW	7	134746436	missense	probably damaging	1.00
R1373:Dock1	UTSW	7	135167175	missense	probably benign	0.01
R1401:Dock1	UTSW	7	135133936	nonsense	probably null
R1454:Dock1	UTSW	7	134851609	splice site	probably benign
R1465:Dock1	UTSW	7	134782409	missense	probably benign	0.00
R1465:Dock1	UTSW	7	134782409	missense	probably benign	0.00
R1523:Dock1	UTSW	7	134744247	missense	possibly damaging	0.49
R1643:Dock1	UTSW	7	135098779	missense	probably damaging	1.00
R1659:Dock1	UTSW	7	134789243	missense	probably damaging	0.98
R1793:Dock1	UTSW	7	135098727	splice site	probably null
R1864:Dock1	UTSW	7	135146507	missense	probably benign	0.07
R1911:Dock1	UTSW	7	134999300	missense	probably damaging	1.00
R2567:Dock1	UTSW	7	135145484	missense	probably damaging	1.00
R3816:Dock1	UTSW	7	134744286	nonsense	probably null
R3971:Dock1	UTSW	7	134746908	missense	probably damaging	1.00
R4063:Dock1	UTSW	7	135115292	missense	possibly damaging	0.81
R4163:Dock1	UTSW	7	134744322	missense	possibly damaging	0.79
R4271:Dock1	UTSW	7	134734054	missense	probably damaging	0.99
R4684:Dock1	UTSW	7	134724409	nonsense	probably null
R4717:Dock1	UTSW	7	134848170	missense	probably damaging	1.00
R4725:Dock1	UTSW	7	134745014	nonsense	probably null
R4788:Dock1	UTSW	7	135145484	missense	probably damaging	0.98
R4869:Dock1	UTSW	7	134734071	missense	probably damaging	1.00
R4889:Dock1	UTSW	7	134744976	missense	probably benign	0.02
R4953:Dock1	UTSW	7	135152288	missense	probably benign	0.34
R5031:Dock1	UTSW	7	135152246	missense	probably benign	0.02
R5168:Dock1	UTSW	7	135118908	missense	probably damaging	1.00
R5212:Dock1	UTSW	7	134789194	missense	possibly damaging	0.68
R5648:Dock1	UTSW	7	134746954	missense	probably damaging	1.00
R5685:Dock1	UTSW	7	134772362	missense	probably benign	0.19
R5834:Dock1	UTSW	7	134763933	missense	probably damaging	1.00
R6181:Dock1	UTSW	7	135158522	missense	probably damaging	1.00
R6334:Dock1	UTSW	7	134851576	missense	probably benign	0.01
R6406:Dock1	UTSW	7	135145486	missense	probably benign	0.26
R6425:Dock1	UTSW	7	135163381	missense	possibly damaging	0.79
R6489:Dock1	UTSW	7	134990541	missense	probably damaging	0.99
R6616:Dock1	UTSW	7	135108492	missense	possibly damaging	0.85
R6706:Dock1	UTSW	7	135133886	missense	possibly damaging	0.72
R6766:Dock1	UTSW	7	134756793	intron	probably null
R6861:Dock1	UTSW	7	134771478	missense	probably benign	0.00
R6985:Dock1	UTSW	7	135163403	missense	possibly damaging	0.95
R7259:Dock1	UTSW	7	134782748	missense	probably damaging	0.99
R7285:Dock1	UTSW	7	134745008	missense	probably benign	0.01
R7471:Dock1	UTSW	7	135163343	missense	possibly damaging	0.65
R7497:Dock1	UTSW	7	134765274	missense	probably benign
R7691:Dock1	UTSW	7	135138157	critical splice donor site	probably null
R7732:Dock1	UTSW	7	134744970	missense	probably benign	0.01
R7818:Dock1	UTSW	7	134763865	missense	probably damaging	1.00
R8009:Dock1	UTSW	7	134745057	missense	not run
R8060:Dock1	UTSW	7	135168403	missense	not run
R8061:Dock1	UTSW	7	134772323	missense	not run
X0062:Dock1	UTSW	7	135108451	missense	probably damaging	1.00
Z1088:Dock1	UTSW	7	134804547	missense	probably damaging	0.98
Z1177:Dock1	UTSW	7	134782400	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACAAGCTGATTGGGAGATTCTC -3'
(R):5'- GGGTACATGAGTCTAAGTGCG -3'

Sequencing Primer
(F):5'- CTGATTGGGAGATTCTCTTTTATGCC -3'
(R):5'- GTAGGTGCTCTTAACCAATGAGCC -3'

Posted On

2016-06-21