Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Fbxl8'

397000

Institutional Source

Beutler Lab

Gene Symbol

Fbxl8

Ensembl Gene

ENSMUSG00000033313

Gene Name

F-box and leucine-rich repeat protein 8

Synonyms

FBL8

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5161 (G1)

Quality Score

125

Status

Validated

Chromosome

Chromosomal Location

105264648-105269326 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105268906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 350 (H350L)

Ref Sequence

ENSEMBL: ENSMUSP00000038638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034359] [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000144762] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]

AlphaFold

Q8CIG9

Predicted Effect

probably benign
Transcript: ENSMUST00000034359

SMART Domains

Protein: ENSMUSP00000034359
Gene: ENSMUSG00000031887

Domain	Start	End	E-Value	Type
Pfam:TRADD_N	51	161	2.9e-49	PFAM
DEATH	203	303	1.14e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000036127

SMART Domains

Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249

Domain	Start	End	E-Value	Type
HSF	16	120	1.74e-62	SMART
Blast:HSF	159	383	8e-88	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036221
AA Change: H350L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313
AA Change: H350L

Domain	Start	End	E-Value	Type
FBOX	8	48	2.72e-6	SMART
low complexity region	102	113	N/A	INTRINSIC
low complexity region	252	263	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126923

SMART Domains

Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

Domain	Start	End	E-Value	Type
FBOX	8	48	2.72e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144762

SMART Domains

Protein: ENSMUSP00000119174
Gene: ENSMUSG00000031887

Domain	Start	End	E-Value	Type
PDB:1F2H\|A	1	50	7e-23	PDB
SCOP:d1f3va_	8	50	4e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147670

SMART Domains

Protein: ENSMUSP00000115535
Gene: ENSMUSG00000031887

Domain	Start	End	E-Value	Type
PDB:1F2H\|A	1	56	6e-23	PDB
SCOP:d1f3va_	8	50	1e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163734

SMART Domains

Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249

Domain	Start	End	E-Value	Type
HSF	9	60	1.43e-1	SMART
Blast:HSF	99	323	2e-88	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172525

SMART Domains

Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

Domain	Start	End	E-Value	Type
HSF	16	120	1.74e-62	SMART
Blast:HSF	159	243	3e-36	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173102

Predicted Effect

probably benign
Transcript: ENSMUST00000173640

SMART Domains

Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

Domain	Start	End	E-Value	Type
HSF	16	120	1.74e-62	SMART
Blast:HSF	159	284	1e-50	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173859

SMART Domains

Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249

Domain	Start	End	E-Value	Type
HSF	16	120	1.74e-62	SMART
Blast:HSF	159	353	1e-46	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000174837

SMART Domains

Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

Domain	Start	End	E-Value	Type
HSF	16	120	1.74e-62	SMART
Blast:HSF	159	290	3e-50	BLAST

Meta Mutation Damage Score

0.1839

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class. It shares 78% sequence identity with the mouse protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Fbxl8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02794:Fbxl8	APN	8	105268120	missense	probably benign	0.01
IGL03405:Fbxl8	APN	8	105268120	missense	probably benign	0.07
R0993:Fbxl8	UTSW	8	105267085	missense	probably damaging	1.00
R1861:Fbxl8	UTSW	8	105268929	missense	probably damaging	1.00
R2042:Fbxl8	UTSW	8	105268224	missense	probably damaging	0.96
R3848:Fbxl8	UTSW	8	105267149	missense	probably benign	0.04
R3850:Fbxl8	UTSW	8	105267149	missense	probably benign	0.04
R4957:Fbxl8	UTSW	8	105268195	missense	probably damaging	0.99
R5153:Fbxl8	UTSW	8	105267107	missense	probably damaging	1.00
R6597:Fbxl8	UTSW	8	105268891	missense	probably benign	0.00
R6603:Fbxl8	UTSW	8	105268210	missense	probably damaging	0.98
R6962:Fbxl8	UTSW	8	105268706	missense	possibly damaging	0.71
R7044:Fbxl8	UTSW	8	105267015	start codon destroyed	probably null	0.99
R7566:Fbxl8	UTSW	8	105268306	missense	possibly damaging	0.82
R8027:Fbxl8	UTSW	8	105268126	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTCCCCTCTGCCTGATGAAG -3'
(R):5'- AGTCAACGGAGCCCCTAAAG -3'

Sequencing Primer
(F):5'- TCTCCGGTGACACTGTAGGAC -3'
(R):5'- CCCTAAAGAGACTAGCAACTGGG -3'

Posted On

2016-06-21