Incidental Mutation 'R5161:Fbxl8'
ID 397000
Institutional Source Beutler Lab
Gene Symbol Fbxl8
Ensembl Gene ENSMUSG00000033313
Gene Name F-box and leucine-rich repeat protein 8
Synonyms FBL8
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5161 (G1)
Quality Score 125
Status Validated
Chromosome 8
Chromosomal Location 105264648-105269326 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105268906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 350 (H350L)
Ref Sequence ENSEMBL: ENSMUSP00000038638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034359] [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000144762] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
AlphaFold Q8CIG9
Predicted Effect probably benign
Transcript: ENSMUST00000034359
SMART Domains Protein: ENSMUSP00000034359
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
Pfam:TRADD_N 51 161 2.9e-49 PFAM
DEATH 203 303 1.14e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036127
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000036221
AA Change: H350L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313
AA Change: H350L

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144762
SMART Domains Protein: ENSMUSP00000119174
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 50 7e-23 PDB
SCOP:d1f3va_ 8 50 4e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147670
SMART Domains Protein: ENSMUSP00000115535
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 56 6e-23 PDB
SCOP:d1f3va_ 8 50 1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163734
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172525
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably benign
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173859
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174837
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Meta Mutation Damage Score 0.1839 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class. It shares 78% sequence identity with the mouse protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Fbxl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02794:Fbxl8 APN 8 105268120 missense probably benign 0.01
IGL03405:Fbxl8 APN 8 105268120 missense probably benign 0.07
R0993:Fbxl8 UTSW 8 105267085 missense probably damaging 1.00
R1861:Fbxl8 UTSW 8 105268929 missense probably damaging 1.00
R2042:Fbxl8 UTSW 8 105268224 missense probably damaging 0.96
R3848:Fbxl8 UTSW 8 105267149 missense probably benign 0.04
R3850:Fbxl8 UTSW 8 105267149 missense probably benign 0.04
R4957:Fbxl8 UTSW 8 105268195 missense probably damaging 0.99
R5153:Fbxl8 UTSW 8 105267107 missense probably damaging 1.00
R6597:Fbxl8 UTSW 8 105268891 missense probably benign 0.00
R6603:Fbxl8 UTSW 8 105268210 missense probably damaging 0.98
R6962:Fbxl8 UTSW 8 105268706 missense possibly damaging 0.71
R7044:Fbxl8 UTSW 8 105267015 start codon destroyed probably null 0.99
R7566:Fbxl8 UTSW 8 105268306 missense possibly damaging 0.82
R8027:Fbxl8 UTSW 8 105268126 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCCCTCTGCCTGATGAAG -3'
(R):5'- AGTCAACGGAGCCCCTAAAG -3'

Sequencing Primer
(F):5'- TCTCCGGTGACACTGTAGGAC -3'
(R):5'- CCCTAAAGAGACTAGCAACTGGG -3'
Posted On 2016-06-21