Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Pik3cg'

397009

Institutional Source

Beutler Lab

Gene Symbol

Pik3cg

Ensembl Gene

ENSMUSG00000020573

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma

Synonyms

PI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32173473-32208659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32204978 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 337 (E337K)

Ref Sequence

ENSEMBL: ENSMUSP00000151400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053215
AA Change: E337K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573
AA Change: E337K

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085469
AA Change: E337K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573
AA Change: E337K

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126814

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156904
AA Change: E337K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573
AA Change: E337K

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217915
AA Change: E337K

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220366
AA Change: E337K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.1103

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Pik3cg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pik3cg	APN	12	32205149	missense	probably damaging	1.00
IGL02182:Pik3cg	APN	12	32205273	missense	possibly damaging	0.90
IGL02273:Pik3cg	APN	12	32176810	missense	probably damaging	1.00
IGL02312:Pik3cg	APN	12	32194821	missense	possibly damaging	0.55
IGL02752:Pik3cg	APN	12	32204263	missense	probably damaging	1.00
IGL03107:Pik3cg	APN	12	32200595	missense	probably damaging	1.00
IGL03139:Pik3cg	APN	12	32192223	missense	probably damaging	1.00
IGL03267:Pik3cg	APN	12	32205308	missense	possibly damaging	0.94
IGL03367:Pik3cg	APN	12	32192121	missense	probably benign	0.01
PIT4283001:Pik3cg	UTSW	12	32205865	missense	probably damaging	1.00
PIT4472001:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
PIT4514001:Pik3cg	UTSW	12	32204903	missense	probably damaging	1.00
R0112:Pik3cg	UTSW	12	32195715	splice site	probably benign
R0145:Pik3cg	UTSW	12	32204322	missense	probably benign	0.20
R0279:Pik3cg	UTSW	12	32204791	missense	probably damaging	1.00
R0471:Pik3cg	UTSW	12	32194771	missense	probably damaging	0.99
R0494:Pik3cg	UTSW	12	32204546	missense	possibly damaging	0.84
R0573:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R0631:Pik3cg	UTSW	12	32205203	missense	probably benign
R0699:Pik3cg	UTSW	12	32197342	splice site	probably benign
R0826:Pik3cg	UTSW	12	32195673	missense	possibly damaging	0.78
R1076:Pik3cg	UTSW	12	32195714	splice site	probably benign
R1101:Pik3cg	UTSW	12	32195646	missense	probably null	0.98
R1459:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
R1625:Pik3cg	UTSW	12	32194742	missense	probably damaging	1.00
R1971:Pik3cg	UTSW	12	32192153	missense	probably damaging	1.00
R1992:Pik3cg	UTSW	12	32204025	missense	possibly damaging	0.83
R2109:Pik3cg	UTSW	12	32193710	missense	possibly damaging	0.75
R2319:Pik3cg	UTSW	12	32176736	missense	probably damaging	0.99
R3421:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3422:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3740:Pik3cg	UTSW	12	32205224	missense	probably damaging	1.00
R3777:Pik3cg	UTSW	12	32194709	missense	probably damaging	0.98
R4300:Pik3cg	UTSW	12	32176672	missense	probably damaging	1.00
R4395:Pik3cg	UTSW	12	32204092	missense	probably damaging	1.00
R4725:Pik3cg	UTSW	12	32193597	critical splice donor site	probably null
R4785:Pik3cg	UTSW	12	32205199	missense	probably damaging	0.97
R4809:Pik3cg	UTSW	12	32204081	missense	possibly damaging	0.46
R4981:Pik3cg	UTSW	12	32204104	missense	possibly damaging	0.77
R5033:Pik3cg	UTSW	12	32199196	splice site	probably null
R5806:Pik3cg	UTSW	12	32204953	missense	possibly damaging	0.88
R6136:Pik3cg	UTSW	12	32204359	missense	probably benign	0.00
R6746:Pik3cg	UTSW	12	32194758	missense	probably damaging	1.00
R6895:Pik3cg	UTSW	12	32204347	missense	possibly damaging	0.87
R7000:Pik3cg	UTSW	12	32192129	missense	probably damaging	1.00
R7089:Pik3cg	UTSW	12	32176846	missense	probably benign	0.00
R7113:Pik3cg	UTSW	12	32205667	missense	probably damaging	0.98
R7372:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R7483:Pik3cg	UTSW	12	32195648	missense	probably damaging	0.99
R7596:Pik3cg	UTSW	12	32204741	missense	probably damaging	1.00
R7771:Pik3cg	UTSW	12	32204014	missense	probably benign
R7910:Pik3cg	UTSW	12	32200517	missense	probably benign	0.16
R7991:Pik3cg	UTSW	12	32200517	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AGAGTACCTCTTCTGCGAAGGG -3'
(R):5'- TTTGTGGCCGCGATGAGTAC -3'

Sequencing Primer
(F):5'- GTTCTCCTTTGGCAGAGGAC -3'
(R):5'- CGCGATGAGTACCTGGTG -3'

Posted On

2016-06-21