Incidental Mutation 'R5161:Apopt1'
ID397012
Institutional Source Beutler Lab
Gene Symbol Apopt1
Ensembl Gene ENSMUSG00000037787
Gene Nameapoptogenic, mitochondrial 1
Synonyms1700081D05Rik, 2810002N01Rik, Apop-1
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111713261-111755053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111722774 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 97 (Q97K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040519] [ENSMUST00000159557] [ENSMUST00000162316] [ENSMUST00000163220]
Predicted Effect probably benign
Transcript: ENSMUST00000040519
AA Change: Q97K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038865
Gene: ENSMUSG00000037787
AA Change: Q97K

DomainStartEndE-ValueType
Pfam:DUF2315 54 182 5.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159897
Predicted Effect possibly damaging
Transcript: ENSMUST00000160366
AA Change: Q97K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123929
Gene: ENSMUSG00000037787
AA Change: Q97K

DomainStartEndE-ValueType
Pfam:DUF2315 53 162 3.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162316
AA Change: Q97K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125711
Gene: ENSMUSG00000037787
AA Change: Q97K

DomainStartEndE-ValueType
Pfam:DUF2315 53 130 7.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163220
AA Change: Q97K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131169
Gene: ENSMUSG00000037787
AA Change: Q97K

DomainStartEndE-ValueType
Pfam:DUF2315 54 162 3.7e-46 PFAM
Meta Mutation Damage Score 0.1419 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the mitochondria, where it stimulates the release of cytochrome c, thereby promoting programmed cell death. Mutations in this gene have been found in individuals with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Apopt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Apopt1 APN 12 111724413 splice site probably benign
R0336:Apopt1 UTSW 12 111733658 intron probably benign
R2324:Apopt1 UTSW 12 111724350 missense possibly damaging 0.87
R4436:Apopt1 UTSW 12 111751208 missense probably benign 0.03
R4774:Apopt1 UTSW 12 111713389 missense possibly damaging 0.66
R5376:Apopt1 UTSW 12 111730058 missense probably damaging 0.96
R5864:Apopt1 UTSW 12 111751218 missense probably benign 0.03
R6802:Apopt1 UTSW 12 111751191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTTAAAGGTCTCAAGATTCTGC -3'
(R):5'- CACAGGATCTCAGTATACATAGTGACC -3'

Sequencing Primer
(F):5'- AAAGGTCTCAAGATTCTGCCCTCC -3'
(R):5'- GACTGGCCTTGAACTAGAGATTCTC -3'
Posted On2016-06-21