Incidental Mutation 'R5161:Timm23'
ID 397015
Institutional Source Beutler Lab
Gene Symbol Timm23
Ensembl Gene ENSMUSG00000013701
Gene Name translocase of inner mitochondrial membrane 23
Synonyms Tim23
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5161 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 32180162-32201898 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32193925 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 63 (P63L)
Ref Sequence ENSEMBL: ENSMUSP00000154804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013845] [ENSMUST00000163379] [ENSMUST00000170331] [ENSMUST00000226683]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000013845
AA Change: P63L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000013845
Gene: ENSMUSG00000013701
AA Change: P63L

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Pfam:Tim17 76 196 6.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104423
Predicted Effect probably benign
Transcript: ENSMUST00000163379
SMART Domains Protein: ENSMUSP00000129688
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170233
Predicted Effect probably benign
Transcript: ENSMUST00000170331
SMART Domains Protein: ENSMUSP00000126977
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172052
Predicted Effect probably damaging
Transcript: ENSMUST00000226683
AA Change: P63L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5422 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex located in the inner mitochondrial membrane that mediates the transport of transit peptide-containing proteins across the membrane. Multiple transcript variants, one protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die prior to E3.5. Mice heterogygous for this allele exhibit background sensitive premature aging and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Timm23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Timm23 APN 14 32180655 missense probably benign 0.34
IGL02023:Timm23 APN 14 32193847 splice site probably benign
R0666:Timm23 UTSW 14 32199036 splice site probably benign
R2214:Timm23 UTSW 14 32198987 missense probably damaging 0.98
R5132:Timm23 UTSW 14 32193945 missense probably damaging 1.00
R5427:Timm23 UTSW 14 32189146 missense possibly damaging 0.95
R6518:Timm23 UTSW 14 32201637 splice site probably null
R7659:Timm23 UTSW 14 32198978 nonsense probably null
R7692:Timm23 UTSW 14 32180563 missense probably damaging 1.00
RF024:Timm23 UTSW 14 32180555 makesense probably null
Predicted Primers PCR Primer
(F):5'- CCATTAACGACTTGGATTTAAGGAC -3'
(R):5'- GGCTGTTATTGCAGACAATTTTAC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- CAAGTACTTGGGAAACTGAGGC -3'
Posted On 2016-06-21