Mutagenetix > Incidental Mutation

Incidental Mutation 'R5161:Ttc23l'

397016

Institutional Source

Beutler Lab

Gene Symbol

Ttc23l

Ensembl Gene

ENSMUSG00000022249

Gene Name

tetratricopeptide repeat domain 23-like

Synonyms

4930401A09Rik

MMRRC Submission

042743-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10500102-10558668 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 10551550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 30 (T30K)

Ref Sequence

ENSEMBL: ENSMUSP00000022857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]

AlphaFold

A6H6E9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022857
AA Change: T30K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: T30K

Domain	Start	End	E-Value	Type
TPR	159	192	4.21e1	SMART
Blast:TPR	208	239	2e-6	BLAST
TPR	250	283	1.4e1	SMART
low complexity region	292	303	N/A	INTRINSIC
TPR	376	409	9.53e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166039

SMART Domains

Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

Domain	Start	End	E-Value	Type
Blast:TPR	183	209	9e-11	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: T30K

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
Pfam:TPR_1	102	133	3.3e-6	PFAM
low complexity region	148	160	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.1531

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Ttc23l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ttc23l	APN	15	10530689	missense	probably damaging	1.00
IGL01319:Ttc23l	APN	15	10509406	splice site	probably benign
IGL01562:Ttc23l	APN	15	10551390	splice site	probably benign
IGL01969:Ttc23l	APN	15	10551434	nonsense	probably null
IGL03172:Ttc23l	APN	15	10537566	missense	probably benign	0.06
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0042:Ttc23l	UTSW	15	10551541	missense	probably damaging	1.00
R0335:Ttc23l	UTSW	15	10539963	missense	probably benign	0.26
R0554:Ttc23l	UTSW	15	10530657	missense	probably benign	0.12
R0609:Ttc23l	UTSW	15	10504536	missense	probably benign
R0631:Ttc23l	UTSW	15	10539980	missense	probably damaging	1.00
R1703:Ttc23l	UTSW	15	10523658	missense	probably damaging	1.00
R2106:Ttc23l	UTSW	15	10547256	missense	probably damaging	1.00
R2220:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2276:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2277:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2278:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2279:Ttc23l	UTSW	15	10523592	missense	possibly damaging	0.92
R2368:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2368:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2420:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2420:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2421:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2422:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2422:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2830:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2831:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2979:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2980:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2980:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2981:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2981:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2982:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2982:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R2983:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R2983:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3176:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3177:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3276:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3277:Ttc23l	UTSW	15	10547232	missense	possibly damaging	0.83
R3722:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3722:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3743:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3743:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R3767:Ttc23l	UTSW	15	10530695	missense	possibly damaging	0.94
R3921:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537563	small insertion	probably benign
R3921:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4091:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4091:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4119:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4120:Ttc23l	UTSW	15	10539920	missense	probably damaging	1.00
R4373:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4373:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4375:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4375:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4376:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4376:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R4377:Ttc23l	UTSW	15	10537562	small insertion	probably benign
R4377:Ttc23l	UTSW	15	10537566	missense	probably benign	0.06
R5002:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5106:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5107:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5109:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5156:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5157:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5160:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5259:Ttc23l	UTSW	15	10515150	missense	probably damaging	0.99
R5307:Ttc23l	UTSW	15	10533659	missense	probably damaging	1.00
R5728:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5756:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5772:Ttc23l	UTSW	15	10551469	missense	probably benign	0.01
R5793:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5794:Ttc23l	UTSW	15	10551550	missense	possibly damaging	0.95
R5847:Ttc23l	UTSW	15	10537596	missense	probably benign	0.07
R6976:Ttc23l	UTSW	15	10537580	nonsense	probably null
R7010:Ttc23l	UTSW	15	10515138	missense	probably damaging	1.00
R7342:Ttc23l	UTSW	15	10551497	missense	probably benign	0.01
R7404:Ttc23l	UTSW	15	10551577	missense	probably damaging	0.98
R7453:Ttc23l	UTSW	15	10533767	missense	probably damaging	1.00
R7584:Ttc23l	UTSW	15	10533708	missense	probably damaging	1.00
R7599:Ttc23l	UTSW	15	10533680	missense	possibly damaging	0.89
R8710:Ttc23l	UTSW	15	10539935	missense	probably damaging	1.00
R8927:Ttc23l	UTSW	15	10530634	missense	probably damaging	1.00
R8928:Ttc23l	UTSW	15	10530634	missense	probably damaging	1.00
R9101:Ttc23l	UTSW	15	10537575	missense	probably benign	0.16
R9746:Ttc23l	UTSW	15	10523643	missense	probably benign	0.01
R9782:Ttc23l	UTSW	15	10530681	missense	probably damaging	1.00
R9792:Ttc23l	UTSW	15	10537645	missense	probably benign
R9793:Ttc23l	UTSW	15	10537645	missense	probably benign
R9795:Ttc23l	UTSW	15	10537645	missense	probably benign
Z1088:Ttc23l	UTSW	15	10533667	missense	probably damaging	1.00
Z1177:Ttc23l	UTSW	15	10533633	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATGCTTTCAAATGACAACC -3'
(R):5'- CCACACTGCTGGCTTAGAAG -3'

Sequencing Primer
(F):5'- TGCTTTCAAATGACAACCTGAAC -3'
(R):5'- CTTAGAAGCTAGGTCTTGAGAGTAG -3'

Posted On

2016-06-21