Mutagenetix > Incidental Mutations

Incidental Mutation 'R5161:Rapgef3'

397018

Institutional Source

Beutler Lab

Gene Symbol

Rapgef3

Ensembl Gene

ENSMUSG00000022469

Gene Name

Rap guanine nucleotide exchange factor (GEF) 3

Synonyms

2310016P22Rik, 9330170P05Rik, Epac1

MMRRC Submission

042743-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97744770-97767972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97757725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 427 (V427A)

Ref Sequence

ENSEMBL: ENSMUSP00000118148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126854] [ENSMUST00000128775] [ENSMUST00000129223] [ENSMUST00000134371] [ENSMUST00000134885] [ENSMUST00000146620] [ENSMUST00000149419] [ENSMUST00000175894] [ENSMUST00000177352]

AlphaFold

Q8VCC8

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123397

Predicted Effect

probably damaging
Transcript: ENSMUST00000126854
AA Change: V427A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000116426
Gene: ENSMUSG00000022469
AA Change: V427A

Domain	Start	End	E-Value	Type
DEP	111	186	2.05e-25	SMART
low complexity region	197	208	N/A	INTRINSIC
low complexity region	230	241	N/A	INTRINSIC
cNMP	245	364	2.53e-12	SMART
RasGEFN	383	514	7.04e-10	SMART
Blast:RasGEF	547	644	6e-45	BLAST
RasGEF	661	926	7.98e-95	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000128775
AA Change: V427A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120126
Gene: ENSMUSG00000022469
AA Change: V427A

Domain	Start	End	E-Value	Type
DEP	111	186	2.05e-25	SMART
low complexity region	197	208	N/A	INTRINSIC
low complexity region	230	241	N/A	INTRINSIC
cNMP	245	364	2.53e-12	SMART
RasGEFN	383	514	7.04e-10	SMART
Blast:RasGEF	547	644	7e-45	BLAST
RasGEF	661	909	5.53e-80	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000129223
AA Change: V427A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118148
Gene: ENSMUSG00000022469
AA Change: V427A

Domain	Start	End	E-Value	Type
DEP	111	186	2.05e-25	SMART
low complexity region	197	208	N/A	INTRINSIC
low complexity region	230	241	N/A	INTRINSIC
cNMP	245	364	2.53e-12	SMART
RasGEFN	383	514	7.04e-10	SMART
Blast:RasGEF	547	644	6e-45	BLAST
RasGEF	661	918	2.11e-85	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134371

SMART Domains

Protein: ENSMUSP00000122746
Gene: ENSMUSG00000022469

Domain	Start	End	E-Value	Type
Blast:cNMP	1	24	9e-8	BLAST
PDB:3CF6\|E	1	67	5e-12	PDB
Blast:RasGEFN	36	67	2e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000134885

SMART Domains

Protein: ENSMUSP00000135317
Gene: ENSMUSG00000022469

Domain	Start	End	E-Value	Type
RasGEF	1	216	2.91e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142196

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146214

Predicted Effect

probably benign
Transcript: ENSMUST00000146620

SMART Domains

Protein: ENSMUSP00000116673
Gene: ENSMUSG00000022469

Domain	Start	End	E-Value	Type
DEP	69	144	2.05e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149373

Predicted Effect

probably benign
Transcript: ENSMUST00000149419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153241

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153464

Predicted Effect

probably benign
Transcript: ENSMUST00000175894

Predicted Effect

probably damaging
Transcript: ENSMUST00000177352
AA Change: V385A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135238
Gene: ENSMUSG00000022469
AA Change: V385A

Domain	Start	End	E-Value	Type
DEP	69	144	2.05e-25	SMART
low complexity region	155	166	N/A	INTRINSIC
low complexity region	188	199	N/A	INTRINSIC
cNMP	203	322	2.53e-12	SMART
RasGEFN	341	472	7.04e-10	SMART
Blast:RasGEF	505	602	3e-45	BLAST
RasGEF	619	884	7.98e-95	SMART

Meta Mutation Damage Score

0.1587

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased induced neuron apoptosis. Mice homozygous for a different allele exhibit impaired glucose homeostasis with decreased insulin secretion, increased susceptibility to diet-induced obesity and streptozotocin-induced insulitis and hyperglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rbbp8	T	G	18: 11,722,114	D465E	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Rapgef3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01314:Rapgef3	APN	15	97748223	missense	probably damaging	1.00
IGL01339:Rapgef3	APN	15	97758059	missense	probably damaging	1.00
IGL01670:Rapgef3	APN	15	97749662	missense	probably benign	0.15
IGL01902:Rapgef3	APN	15	97750300	missense	probably benign	0.32
IGL02137:Rapgef3	APN	15	97750144	missense	probably benign	0.08
IGL02419:Rapgef3	APN	15	97750290	missense	probably benign	0.33
IGL02427:Rapgef3	APN	15	97747136	splice site	probably null
IGL02648:Rapgef3	APN	15	97758392	missense	probably damaging	1.00
IGL02834:Rapgef3	APN	15	97748265	missense	probably damaging	0.98
IGL03389:Rapgef3	APN	15	97749516	missense	probably damaging	1.00
IGL03055:Rapgef3	UTSW	15	97749489	splice site	probably benign
R0394:Rapgef3	UTSW	15	97757819	intron	probably benign
R0538:Rapgef3	UTSW	15	97757817	intron	probably benign
R0744:Rapgef3	UTSW	15	97761585	splice site	probably benign
R1288:Rapgef3	UTSW	15	97759342	missense	probably benign	0.31
R1512:Rapgef3	UTSW	15	97757501	missense	probably benign	0.24
R1676:Rapgef3	UTSW	15	97761182	missense	probably benign	0.35
R1745:Rapgef3	UTSW	15	97750178	missense	probably benign	0.22
R1928:Rapgef3	UTSW	15	97750033	missense	probably damaging	1.00
R2063:Rapgef3	UTSW	15	97766961	missense	probably damaging	1.00
R2067:Rapgef3	UTSW	15	97766961	missense	probably damaging	1.00
R2092:Rapgef3	UTSW	15	97760723	missense	probably damaging	1.00
R4358:Rapgef3	UTSW	15	97748648	missense	probably benign	0.05
R4624:Rapgef3	UTSW	15	97758929	missense	probably damaging	1.00
R4627:Rapgef3	UTSW	15	97758929	missense	probably damaging	1.00
R4727:Rapgef3	UTSW	15	97760600	missense	probably damaging	1.00
R4812:Rapgef3	UTSW	15	97753803	missense	probably benign	0.21
R4928:Rapgef3	UTSW	15	97757375	missense	probably damaging	1.00
R5442:Rapgef3	UTSW	15	97758861	missense	probably damaging	0.99
R5652:Rapgef3	UTSW	15	97758437	missense	probably benign	0.00
R5837:Rapgef3	UTSW	15	97757342	splice site	probably benign
R6056:Rapgef3	UTSW	15	97758861	missense	probably damaging	0.99
R6167:Rapgef3	UTSW	15	97767411	unclassified	probably benign
R6694:Rapgef3	UTSW	15	97759984	missense	probably benign	0.03
R7039:Rapgef3	UTSW	15	97761568	missense	probably benign	0.01
R7154:Rapgef3	UTSW	15	97753877	missense	probably benign
R7380:Rapgef3	UTSW	15	97766791	missense	probably benign	0.00
R7655:Rapgef3	UTSW	15	97761209	missense	probably damaging	1.00
R7656:Rapgef3	UTSW	15	97761209	missense	probably damaging	1.00
R7754:Rapgef3	UTSW	15	97757746	missense	probably damaging	1.00
R7849:Rapgef3	UTSW	15	97758390	critical splice donor site	probably null
R8061:Rapgef3	UTSW	15	97761520	missense	probably benign
R8117:Rapgef3	UTSW	15	97750866	missense	probably benign	0.01
R8179:Rapgef3	UTSW	15	97760740	missense	probably benign	0.06
R8819:Rapgef3	UTSW	15	97748657	missense	probably benign	0.39
R8820:Rapgef3	UTSW	15	97748657	missense	probably benign	0.39
R8824:Rapgef3	UTSW	15	97766908	missense	probably benign	0.39
RF024:Rapgef3	UTSW	15	97760740	missense	probably benign	0.06
X0011:Rapgef3	UTSW	15	97761473	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CAGATGTAGGTGCTGTGCTC -3'
(R):5'- TTGGGTGGAGAGAACTGTCAC -3'

Sequencing Primer
(F):5'- TGAGGCCACCCGTCATACAG -3'
(R):5'- AACTGTCACAGGGGCTGG -3'

Posted On

2016-06-21