Incidental Mutation 'R5161:Acsbg3'
ID 397025
Institutional Source Beutler Lab
Gene Symbol Acsbg3
Ensembl Gene ENSMUSG00000024209
Gene Name acyl-CoA synthetase bubblegum family member 3
Synonyms 1700061G19Rik
MMRRC Submission 042743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R5161 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 57182477-57195904 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57189888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 305 (I305F)
Ref Sequence ENSEMBL: ENSMUSP00000025048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048]
AlphaFold Q08EE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000025048
AA Change: I305F

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209
AA Change: I305F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 64,055,344 (GRCm39) E27* probably null Het
4930407I10Rik G T 15: 81,947,542 (GRCm39) E480* probably null Het
Acad11 T C 9: 104,001,227 (GRCm39) I591T probably benign Het
Adamts13 G A 2: 26,883,020 (GRCm39) E857K probably benign Het
Atf2 A C 2: 73,660,134 (GRCm39) probably null Het
Cass4 C A 2: 172,274,244 (GRCm39) A675E probably damaging Het
Coa8 C A 12: 111,689,208 (GRCm39) Q97K possibly damaging Het
Ctsd A T 7: 141,930,881 (GRCm39) L283Q probably damaging Het
Ddrgk1 A T 2: 130,505,296 (GRCm39) M1K probably null Het
Dipk1b C T 2: 26,526,260 (GRCm39) T398M possibly damaging Het
Dock1 G A 7: 134,335,791 (GRCm39) A62T possibly damaging Het
Ehmt1 T C 2: 24,748,207 (GRCm39) D407G possibly damaging Het
Eif1ad17 T A 12: 87,978,887 (GRCm39) D90E possibly damaging Het
Eml6 A G 11: 29,974,467 (GRCm39) V37A probably damaging Het
Fam20a C T 11: 109,564,196 (GRCm39) R519Q probably benign Het
Fat1 A G 8: 45,405,549 (GRCm39) T767A probably benign Het
Fbxl8 A T 8: 105,995,538 (GRCm39) H350L possibly damaging Het
Gm10226 A C 17: 21,910,834 (GRCm39) Q23P possibly damaging Het
Gm38706 A T 6: 130,459,868 (GRCm39) noncoding transcript Het
Gpatch2l G T 12: 86,313,950 (GRCm39) R362L probably benign Het
Hyal5 A T 6: 24,891,602 (GRCm39) D472V probably benign Het
Ighv5-9-1 T C 12: 113,699,777 (GRCm39) S102G possibly damaging Het
Itpripl1 A C 2: 126,983,777 (GRCm39) L115R probably damaging Het
Itsn1 G A 16: 91,705,726 (GRCm39) C169Y possibly damaging Het
Krt88 T A 15: 101,348,349 (GRCm39) C12S probably benign Het
Macroh2a1 T C 13: 56,237,594 (GRCm39) D222G probably benign Het
Muc4 G A 16: 32,582,895 (GRCm39) V2557M probably damaging Het
Myh7b G C 2: 155,474,293 (GRCm39) R1669S possibly damaging Het
Nbeal2 G T 9: 110,458,936 (GRCm39) Q1996K probably benign Het
Obscn T C 11: 58,919,430 (GRCm39) E6205G probably damaging Het
Obscn A G 11: 58,955,136 (GRCm39) Y3926H possibly damaging Het
Or14a259 T C 7: 86,013,546 (GRCm39) probably null Het
Or5an10 A T 19: 12,276,153 (GRCm39) S114R probably damaging Het
P2ry2 A T 7: 100,648,136 (GRCm39) Y56* probably null Het
Pate10 T A 9: 35,652,884 (GRCm39) L42* probably null Het
Pde1a T C 2: 79,708,488 (GRCm39) N242S probably null Het
Pik3cg C T 12: 32,254,977 (GRCm39) E337K possibly damaging Het
Plxna2 A G 1: 194,433,712 (GRCm39) N587S probably benign Het
Pmpca T C 2: 26,285,183 (GRCm39) probably null Het
Ptpn4 C T 1: 119,635,593 (GRCm39) W370* probably null Het
Qki A T 17: 10,434,419 (GRCm39) probably null Het
Rapgef3 A G 15: 97,655,606 (GRCm39) V427A probably damaging Het
Rbbp8 T G 18: 11,855,171 (GRCm39) D465E probably damaging Het
Scn2a A G 2: 65,594,935 (GRCm39) K1928R probably benign Het
Slc5a5 A C 8: 71,341,492 (GRCm39) C346G probably damaging Het
Spata2l A G 8: 123,962,288 (GRCm39) L91P probably damaging Het
Syt3 C A 7: 44,045,439 (GRCm39) H560N possibly damaging Het
Timm23 G A 14: 31,915,882 (GRCm39) P63L probably damaging Het
Tmem191 T C 16: 17,094,743 (GRCm39) S108P possibly damaging Het
Ttc21b A G 2: 66,059,367 (GRCm39) C545R probably damaging Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Usp17ld A T 7: 102,899,579 (GRCm39) L451* probably null Het
Vmn1r15 T C 6: 57,235,497 (GRCm39) Y122H probably benign Het
Vxn G T 1: 9,692,902 (GRCm39) G145* probably null Het
Zfp1002 A T 2: 150,097,135 (GRCm39) I98K probably damaging Het
Other mutations in Acsbg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Acsbg3 APN 17 57,189,203 (GRCm39) nonsense probably null
IGL01833:Acsbg3 APN 17 57,188,062 (GRCm39) missense probably benign 0.02
IGL02420:Acsbg3 APN 17 57,187,494 (GRCm39) missense probably damaging 1.00
IGL02969:Acsbg3 APN 17 57,190,751 (GRCm39) missense probably damaging 1.00
IGL03054:Acsbg3 UTSW 17 57,193,528 (GRCm39) missense possibly damaging 0.67
R0197:Acsbg3 UTSW 17 57,190,835 (GRCm39) missense probably benign 0.01
R0257:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0279:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0280:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0281:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0282:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0329:Acsbg3 UTSW 17 57,190,631 (GRCm39) missense probably benign 0.02
R0330:Acsbg3 UTSW 17 57,190,631 (GRCm39) missense probably benign 0.02
R0349:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0518:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0519:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0521:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0604:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R0883:Acsbg3 UTSW 17 57,190,835 (GRCm39) missense probably benign 0.01
R1561:Acsbg3 UTSW 17 57,184,431 (GRCm39) missense probably benign
R1779:Acsbg3 UTSW 17 57,192,169 (GRCm39) nonsense probably null
R2008:Acsbg3 UTSW 17 57,193,478 (GRCm39) missense probably benign 0.04
R2102:Acsbg3 UTSW 17 57,191,949 (GRCm39) nonsense probably null
R2247:Acsbg3 UTSW 17 57,184,435 (GRCm39) missense possibly damaging 0.83
R2484:Acsbg3 UTSW 17 57,189,641 (GRCm39) missense probably benign 0.00
R2917:Acsbg3 UTSW 17 57,192,141 (GRCm39) missense probably damaging 1.00
R3149:Acsbg3 UTSW 17 57,183,348 (GRCm39) missense probably benign
R3773:Acsbg3 UTSW 17 57,183,262 (GRCm39) start codon destroyed probably null 0.00
R4829:Acsbg3 UTSW 17 57,190,500 (GRCm39) splice site probably null
R4860:Acsbg3 UTSW 17 57,195,655 (GRCm39) missense probably benign 0.09
R4860:Acsbg3 UTSW 17 57,195,655 (GRCm39) missense probably benign 0.09
R4887:Acsbg3 UTSW 17 57,183,324 (GRCm39) missense possibly damaging 0.84
R5043:Acsbg3 UTSW 17 57,192,198 (GRCm39) missense probably damaging 1.00
R5112:Acsbg3 UTSW 17 57,184,465 (GRCm39) missense probably benign 0.03
R5214:Acsbg3 UTSW 17 57,193,493 (GRCm39) missense probably benign
R5287:Acsbg3 UTSW 17 57,183,221 (GRCm39) unclassified probably benign
R5403:Acsbg3 UTSW 17 57,183,221 (GRCm39) unclassified probably benign
R5779:Acsbg3 UTSW 17 57,188,061 (GRCm39) missense probably benign 0.02
R5997:Acsbg3 UTSW 17 57,183,373 (GRCm39) missense probably benign 0.02
R6198:Acsbg3 UTSW 17 57,189,679 (GRCm39) missense probably damaging 1.00
R6259:Acsbg3 UTSW 17 57,184,513 (GRCm39) missense probably benign 0.04
R6357:Acsbg3 UTSW 17 57,184,591 (GRCm39) critical splice donor site probably null
R6754:Acsbg3 UTSW 17 57,190,358 (GRCm39) missense probably damaging 0.99
R6842:Acsbg3 UTSW 17 57,184,432 (GRCm39) missense probably benign 0.00
R7042:Acsbg3 UTSW 17 57,192,098 (GRCm39) missense possibly damaging 0.73
R7181:Acsbg3 UTSW 17 57,188,037 (GRCm39) missense probably benign 0.03
R7445:Acsbg3 UTSW 17 57,189,973 (GRCm39) missense possibly damaging 0.64
R7511:Acsbg3 UTSW 17 57,189,954 (GRCm39) missense probably damaging 0.98
R8122:Acsbg3 UTSW 17 57,193,670 (GRCm39) missense possibly damaging 0.50
R8553:Acsbg3 UTSW 17 57,188,021 (GRCm39) missense probably benign 0.02
R8919:Acsbg3 UTSW 17 57,189,218 (GRCm39) missense probably benign 0.00
R9460:Acsbg3 UTSW 17 57,183,316 (GRCm39) missense probably damaging 0.99
R9469:Acsbg3 UTSW 17 57,183,283 (GRCm39) missense probably benign 0.00
R9766:Acsbg3 UTSW 17 57,189,177 (GRCm39) missense probably benign 0.02
Z1177:Acsbg3 UTSW 17 57,190,463 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAGTAATGGCCCTCTCTGAG -3'
(R):5'- TGTACCACAGCAAGGAACAG -3'

Sequencing Primer
(F):5'- TCTCTGAGGGGCTGGCC -3'
(R):5'- GGAACAGAGTGACCATTCCC -3'
Posted On 2016-06-21