Mutagenetix > Incidental Mutation

Incidental Mutation 'R5161:Rbbp8'

397026

Institutional Source

Beutler Lab

Gene Symbol

Rbbp8

Ensembl Gene

ENSMUSG00000041238

Gene Name

retinoblastoma binding protein 8, endonuclease

Synonyms

9930104E21Rik, CtIP

MMRRC Submission

042743-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11633276-11743207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 11722114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 465 (D465E)

Ref Sequence

ENSEMBL: ENSMUSP00000111527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]

AlphaFold

Q80YR6

Predicted Effect

probably damaging
Transcript: ENSMUST00000047322
AA Change: D465E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: D465E

Domain	Start	End	E-Value	Type
Pfam:CtIP_N	20	139	9.6e-61	PFAM
PDB:2L4Z\|A	639	675	3e-15	PDB
Pfam:SAE2	790	854	8.7e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115861
AA Change: D465E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: D465E

Domain	Start	End	E-Value	Type
Pfam:CtIP_N	20	139	5.2e-55	PFAM
PDB:2L4Z\|A	639	675	3e-15	PDB
Pfam:SAE2	817	854	1.4e-8	PFAM

Meta Mutation Damage Score

0.0642

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,001	E27*	probably null	Het
1700061G19Rik	A	T	17: 56,882,888	I305F	possibly damaging	Het
3110035E14Rik	G	T	1: 9,622,677	G145*	probably null	Het
4930407I10Rik	G	T	15: 82,063,341	E480*	probably null	Het
Acad11	T	C	9: 104,124,028	I591T	probably benign	Het
Adamts13	G	A	2: 26,993,008	E857K	probably benign	Het
Apopt1	C	A	12: 111,722,774	Q97K	possibly damaging	Het
Atf2	A	C	2: 73,829,790		probably null	Het
Cass4	C	A	2: 172,432,324	A675E	probably damaging	Het
Ctsd	A	T	7: 142,377,144	L283Q	probably damaging	Het
Ddrgk1	A	T	2: 130,663,376	M1K	probably null	Het
Dock1	G	A	7: 134,734,062	A62T	possibly damaging	Het
Ehmt1	T	C	2: 24,858,195	D407G	possibly damaging	Het
Eml6	A	G	11: 30,024,467	V37A	probably damaging	Het
Fam20a	C	T	11: 109,673,370	R519Q	probably benign	Het
Fam69b	C	T	2: 26,636,248	T398M	possibly damaging	Het
Fat1	A	G	8: 44,952,512	T767A	probably benign	Het
Fbxl8	A	T	8: 105,268,906	H350L	possibly damaging	Het
Gm10226	A	C	17: 21,691,927	Q23P	possibly damaging	Het
Gm17677	T	A	9: 35,741,588	L42*	probably null	Het
Gm2075	T	A	12: 88,012,117	D90E	possibly damaging	Het
Gm21994	A	T	2: 150,255,215	I98K	probably damaging	Het
Gm38706	A	T	6: 130,482,905		noncoding transcript	Het
Gpatch2l	G	T	12: 86,267,176	R362L	probably benign	Het
H2afy	T	C	13: 56,089,781	D222G	probably benign	Het
Hyal5	A	T	6: 24,891,603	D472V	probably benign	Het
Ighv5-9-1	T	C	12: 113,736,157	S102G	possibly damaging	Het
Itpripl1	A	C	2: 127,141,857	L115R	probably damaging	Het
Itsn1	G	A	16: 91,908,838	C169Y	possibly damaging	Het
Krt88	T	A	15: 101,450,468	C12S	probably benign	Het
Muc4	G	A	16: 32,762,521	V2557M	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nbeal2	G	T	9: 110,629,868	Q1996K	probably benign	Het
Obscn	T	C	11: 59,028,604	E6205G	probably damaging	Het
Obscn	A	G	11: 59,064,310	Y3926H	possibly damaging	Het
Olfr1436	A	T	19: 12,298,789	S114R	probably damaging	Het
Olfr305	T	C	7: 86,364,338		probably null	Het
P2ry2	A	T	7: 100,998,929	Y56*	probably null	Het
Pde1a	T	C	2: 79,878,144	N242S	probably null	Het
Pik3cg	C	T	12: 32,204,978	E337K	possibly damaging	Het
Plxna2	A	G	1: 194,751,404	N587S	probably benign	Het
Pmpca	T	C	2: 26,395,171		probably null	Het
Ptpn4	C	T	1: 119,707,863	W370*	probably null	Het
Qk	A	T	17: 10,215,490		probably null	Het
Rapgef3	A	G	15: 97,757,725	V427A	probably damaging	Het
Scn2a	A	G	2: 65,764,591	K1928R	probably benign	Het
Slc5a5	A	C	8: 70,888,848	C346G	probably damaging	Het
Spata2l	A	G	8: 123,235,549	L91P	probably damaging	Het
Syt3	C	A	7: 44,396,015	H560N	possibly damaging	Het
Timm23	G	A	14: 32,193,925	P63L	probably damaging	Het
Tmem191c	T	C	16: 17,276,879	S108P	possibly damaging	Het
Ttc21b	A	G	2: 66,229,023	C545R	probably damaging	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp17ld	A	T	7: 103,250,372	L451*	probably null	Het
Vmn1r15	T	C	6: 57,258,512	Y122H	probably benign	Het

Other mutations in Rbbp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Rbbp8	APN	18	11722607	missense	probably benign
IGL01302:Rbbp8	APN	18	11721979	missense	probably benign
IGL01965:Rbbp8	APN	18	11722260	missense	probably benign	0.04
IGL02076:Rbbp8	APN	18	11705819	missense	probably damaging	1.00
IGL02410:Rbbp8	APN	18	11732212	missense	probably damaging	1.00
IGL02823:Rbbp8	APN	18	11732213	missense	possibly damaging	0.89
IGL02859:Rbbp8	APN	18	11738614	missense	probably benign	0.42
IGL02966:Rbbp8	APN	18	11705812	missense	possibly damaging	0.88
IGL03022:Rbbp8	APN	18	11725502	splice site	probably benign
IGL03274:Rbbp8	APN	18	11741076	splice site	probably benign
IGL03367:Rbbp8	APN	18	11721719	missense	probably benign	0.08
R0063:Rbbp8	UTSW	18	11734557	splice site	probably benign
R0063:Rbbp8	UTSW	18	11734557	splice site	probably benign
R0167:Rbbp8	UTSW	18	11660922	nonsense	probably null
R0314:Rbbp8	UTSW	18	11715818	missense	probably benign	0.17
R0864:Rbbp8	UTSW	18	11732184	splice site	probably benign
R1033:Rbbp8	UTSW	18	11742705	missense	probably benign	0.41
R1678:Rbbp8	UTSW	18	11732315	missense	probably benign	0.05
R1964:Rbbp8	UTSW	18	11742679	missense	possibly damaging	0.62
R2002:Rbbp8	UTSW	18	11727166	splice site	probably benign
R2015:Rbbp8	UTSW	18	11720624	missense	probably benign	0.01
R2240:Rbbp8	UTSW	18	11677669	missense	probably damaging	0.99
R2308:Rbbp8	UTSW	18	11696776	missense	possibly damaging	0.95
R3946:Rbbp8	UTSW	18	11718868	missense	probably benign
R4375:Rbbp8	UTSW	18	11725410	missense	probably benign	0.00
R4590:Rbbp8	UTSW	18	11732265	nonsense	probably null
R4695:Rbbp8	UTSW	18	11721782	nonsense	probably null
R4769:Rbbp8	UTSW	18	11722670	missense	probably damaging	1.00
R5195:Rbbp8	UTSW	18	11722151	missense	probably benign	0.00
R5223:Rbbp8	UTSW	18	11721690	missense	probably benign	0.19
R5573:Rbbp8	UTSW	18	11722607	missense	probably benign
R5671:Rbbp8	UTSW	18	11742642	missense	probably benign	0.00
R6051:Rbbp8	UTSW	18	11738607	missense	probably benign	0.17
R6995:Rbbp8	UTSW	18	11718908	missense	probably damaging	1.00
R7048:Rbbp8	UTSW	18	11732220	missense	possibly damaging	0.92
R7261:Rbbp8	UTSW	18	11705742	missense	probably damaging	0.99
R7305:Rbbp8	UTSW	18	11672581	critical splice acceptor site	probably null
R7319:Rbbp8	UTSW	18	11732212	missense	probably damaging	1.00
R7447:Rbbp8	UTSW	18	11660877	missense	probably benign	0.00
R7949:Rbbp8	UTSW	18	11718835	missense	probably benign	0.00
R8010:Rbbp8	UTSW	18	11722233	missense	possibly damaging	0.67
R8116:Rbbp8	UTSW	18	11722670	missense	probably damaging	1.00
R8292:Rbbp8	UTSW	18	11705712	missense	probably benign
R8300:Rbbp8	UTSW	18	11705776	synonymous	silent
R8314:Rbbp8	UTSW	18	11720625	missense	probably benign	0.06
R8510:Rbbp8	UTSW	18	11696802	nonsense	probably null
R8961:Rbbp8	UTSW	18	11732205	missense	probably benign	0.18
R9056:Rbbp8	UTSW	18	11677620	missense	possibly damaging	0.65
R9086:Rbbp8	UTSW	18	11742679	missense	possibly damaging	0.62
R9375:Rbbp8	UTSW	18	11705831	missense	probably benign
R9391:Rbbp8	UTSW	18	11721933	missense	possibly damaging	0.49
R9763:Rbbp8	UTSW	18	11732204	missense	probably benign	0.01
Z1176:Rbbp8	UTSW	18	11732262	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGTCAGAAGTGAAGGTCATTAGCC -3'
(R):5'- AGCCTCGTAAATAGTGGCTTG -3'

Sequencing Primer
(F):5'- GTGAAGGTCATTAGCCAGTCATTTTC -3'
(R):5'- CCTCGTAAATAGTGGCTTGCTTAAG -3'

Posted On

2016-06-21