Incidental Mutation 'R5162:Tyw5'
ID397029
Institutional Source Beutler Lab
Gene Symbol Tyw5
Ensembl Gene ENSMUSG00000048495
Gene NametRNA-yW synthesizing protein 5
Synonyms1110034B05Rik
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location57388237-57407101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57401459 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 48 (Y48C)
Ref Sequence ENSEMBL: ENSMUSP00000125427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027114] [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
Predicted Effect probably benign
Transcript: ENSMUST00000027114
SMART Domains Protein: ENSMUSP00000027114
Gene: ENSMUSG00000025971

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Blast:Tim44 131 210 3e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000079998
AA Change: Y48C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495
AA Change: Y48C

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097732
Predicted Effect probably damaging
Transcript: ENSMUST00000160118
AA Change: Y48C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495
AA Change: Y48C

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000160837
AA Change: Y42C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495
AA Change: Y42C

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161780
SMART Domains Protein: ENSMUSP00000125487
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000162686
AA Change: Y48C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495
AA Change: Y48C

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163039
Meta Mutation Damage Score 0.6980 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Tyw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Tyw5 APN 1 57388553 nonsense probably null
IGL01565:Tyw5 APN 1 57394081 missense probably damaging 1.00
IGL01675:Tyw5 APN 1 57388632 missense possibly damaging 0.94
IGL01915:Tyw5 APN 1 57401469 missense probably damaging 0.99
IGL02320:Tyw5 APN 1 57396725 critical splice donor site probably null
IGL02427:Tyw5 APN 1 57388725 missense possibly damaging 0.68
PIT4520001:Tyw5 UTSW 1 57388515 missense probably damaging 1.00
R0053:Tyw5 UTSW 1 57401438 missense probably damaging 0.97
R0053:Tyw5 UTSW 1 57401438 missense probably damaging 0.97
R2421:Tyw5 UTSW 1 57396748 missense possibly damaging 0.58
R2422:Tyw5 UTSW 1 57396748 missense possibly damaging 0.58
R2997:Tyw5 UTSW 1 57388641 missense probably damaging 1.00
R3974:Tyw5 UTSW 1 57391528 missense probably damaging 1.00
R4235:Tyw5 UTSW 1 57388488 utr 3 prime probably benign
R4630:Tyw5 UTSW 1 57388527 missense probably damaging 0.96
R5014:Tyw5 UTSW 1 57406845 start gained probably benign
R5099:Tyw5 UTSW 1 57388705 missense probably damaging 0.99
R6389:Tyw5 UTSW 1 57391499 missense probably damaging 1.00
R6422:Tyw5 UTSW 1 57401411 missense probably damaging 0.99
R6524:Tyw5 UTSW 1 57388731 missense possibly damaging 0.67
R6908:Tyw5 UTSW 1 57401523 missense probably damaging 1.00
R7633:Tyw5 UTSW 1 57393485 missense probably benign 0.01
X0018:Tyw5 UTSW 1 57390663 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCCACAGAACACAGGGTG -3'
(R):5'- TCAAGTAGAGAGGCCATGGC -3'

Sequencing Primer
(F):5'- ACCTGTGGAAAATGTCTCTGTAC -3'
(R):5'- AGAGGCCATGGCAATACTTATGTTG -3'
Posted On2016-06-21