Incidental Mutation 'R5162:Ehmt1'
ID397031
Institutional Source Beutler Lab
Gene Symbol Ehmt1
Ensembl Gene ENSMUSG00000036893
Gene Nameeuchromatic histone methyltransferase 1
SynonymsKMT1D, 9230102N17Rik
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24789928-24919614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24877497 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 135 (P135T)
Ref Sequence ENSEMBL: ENSMUSP00000143189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046227] [ENSMUST00000091348] [ENSMUST00000102938] [ENSMUST00000114418] [ENSMUST00000114432] [ENSMUST00000147147] [ENSMUST00000150379] [ENSMUST00000152161] [ENSMUST00000198923] [ENSMUST00000200655]
Predicted Effect probably damaging
Transcript: ENSMUST00000046227
AA Change: P259T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046077
Gene: ENSMUSG00000036893
AA Change: P259T

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091348
AA Change: P258T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088906
Gene: ENSMUSG00000036893
AA Change: P258T

DomainStartEndE-ValueType
low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 763 792 2.02e-5 SMART
ANK 796 827 3.06e-5 SMART
ANK 829 859 1.69e-7 SMART
ANK 863 892 6.65e-6 SMART
ANK 896 925 7.71e-2 SMART
ANK 929 958 6.12e-5 SMART
ANK 962 995 7.29e2 SMART
PreSET 1002 1101 1.05e-30 SMART
SET 1117 1240 2.24e-43 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102938
AA Change: P259T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100002
Gene: ENSMUSG00000036893
AA Change: P259T

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 770 799 2.02e-5 SMART
ANK 803 834 3.06e-5 SMART
ANK 836 866 1.69e-7 SMART
ANK 870 899 6.65e-6 SMART
ANK 903 932 7.71e-2 SMART
ANK 936 965 6.12e-5 SMART
ANK 969 1002 7.29e2 SMART
PreSET 1009 1108 1.05e-30 SMART
SET 1124 1247 2.24e-43 SMART
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114418
AA Change: P259T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110061
Gene: ENSMUSG00000036893
AA Change: P259T

DomainStartEndE-ValueType
low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114432
AA Change: P259T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110075
Gene: ENSMUSG00000036893
AA Change: P259T

DomainStartEndE-ValueType
low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 717 746 2.02e-5 SMART
ANK 750 781 3.06e-5 SMART
ANK 783 813 1.69e-7 SMART
ANK 817 846 6.65e-6 SMART
ANK 850 879 7.71e-2 SMART
ANK 883 912 6.12e-5 SMART
ANK 916 949 7.29e2 SMART
PreSET 956 1055 1.05e-30 SMART
SET 1071 1194 2.24e-43 SMART
low complexity region 1211 1224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139000
Predicted Effect probably damaging
Transcript: ENSMUST00000147147
AA Change: P259T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119057
Gene: ENSMUSG00000036893
AA Change: P259T

DomainStartEndE-ValueType
low complexity region 252 271 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 352 364 N/A INTRINSIC
ANK 634 663 2.02e-5 SMART
ANK 667 698 3.06e-5 SMART
ANK 700 730 1.69e-7 SMART
ANK 734 763 6.65e-6 SMART
ANK 767 796 7.71e-2 SMART
ANK 800 829 6.12e-5 SMART
ANK 833 866 7.29e2 SMART
PreSET 873 972 1.05e-30 SMART
SET 988 1111 2.24e-43 SMART
low complexity region 1128 1141 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150379
AA Change: P261T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000152161
AA Change: P258T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119854
Gene: ENSMUSG00000036893
AA Change: P258T

DomainStartEndE-ValueType
low complexity region 339 358 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152325
AA Change: P7T
SMART Domains Protein: ENSMUSP00000123387
Gene: ENSMUSG00000036893
AA Change: P7T

DomainStartEndE-ValueType
low complexity region 89 108 N/A INTRINSIC
low complexity region 147 168 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192397
Predicted Effect probably damaging
Transcript: ENSMUST00000198923
AA Change: P135T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143189
Gene: ENSMUSG00000036893
AA Change: P135T

DomainStartEndE-ValueType
low complexity region 208 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200655
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that is part of the E2F6 complex, which represses transcription. The encoded protein methylates the Lys-9 position of histone H3, which tags it for transcriptional repression. This protein may be involved in the silencing of MYC- and E2F-responsive genes and therefore could play a role in the G0/G1 cell cycle transition. Defects in this gene are a cause of chromosome 9q subtelomeric deletion syndrome (9q-syndrome, also known as Kleefstra syndrome). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Nullizygous embryos die circa E9.5 showing delayed growth and incomplete somite formation and neural groove closure. Heterozygotes show behavioral deficits and synaptic dysfunction. Homozygotes with a H3K9me1-binding mutant form show delayed prenatal growth and bone ossification and postnatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Ehmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ehmt1 APN 2 24838818 missense possibly damaging 0.81
IGL01403:Ehmt1 APN 2 24839626 missense possibly damaging 0.81
IGL01636:Ehmt1 APN 2 24839608 missense probably damaging 0.97
IGL01804:Ehmt1 APN 2 24791954 missense probably damaging 1.00
IGL01836:Ehmt1 APN 2 24863220 splice site probably null
IGL02740:Ehmt1 APN 2 24815839 splice site probably benign
IGL02750:Ehmt1 APN 2 24863869 missense probably damaging 1.00
IGL03026:Ehmt1 APN 2 24852734 missense probably benign
IGL02799:Ehmt1 UTSW 2 24815806 missense probably damaging 1.00
R0908:Ehmt1 UTSW 2 24804888 missense probably damaging 1.00
R1275:Ehmt1 UTSW 2 24886995 critical splice donor site probably null
R1665:Ehmt1 UTSW 2 24877464 missense probably damaging 1.00
R1707:Ehmt1 UTSW 2 24805138 missense probably benign
R1800:Ehmt1 UTSW 2 24884290 missense probably damaging 0.99
R2108:Ehmt1 UTSW 2 24837618 missense probably damaging 1.00
R2113:Ehmt1 UTSW 2 24804003 missense probably damaging 1.00
R2393:Ehmt1 UTSW 2 24806217 missense probably damaging 1.00
R2570:Ehmt1 UTSW 2 24815741 missense probably damaging 1.00
R3923:Ehmt1 UTSW 2 24884335 synonymous probably null
R4646:Ehmt1 UTSW 2 24891684 missense probably null 0.01
R4924:Ehmt1 UTSW 2 24839722 missense probably damaging 0.97
R4989:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5040:Ehmt1 UTSW 2 24884304 missense probably benign 0.19
R5110:Ehmt1 UTSW 2 24852790 missense probably benign 0.01
R5133:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5134:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5161:Ehmt1 UTSW 2 24858195 missense possibly damaging 0.71
R5183:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5184:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5208:Ehmt1 UTSW 2 24801533 missense probably benign 0.34
R5309:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5312:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5837:Ehmt1 UTSW 2 24863914 missense probably damaging 0.98
R5968:Ehmt1 UTSW 2 24836457 missense probably damaging 0.99
R6539:Ehmt1 UTSW 2 24804767 missense probably damaging 1.00
R6646:Ehmt1 UTSW 2 24806310 missense probably damaging 0.99
R7065:Ehmt1 UTSW 2 24840697 missense probably damaging 1.00
R7226:Ehmt1 UTSW 2 24804782 missense probably damaging 1.00
R7361:Ehmt1 UTSW 2 24856701 missense possibly damaging 0.94
R7373:Ehmt1 UTSW 2 24919573 start codon destroyed probably null 0.03
R7410:Ehmt1 UTSW 2 24848068 missense probably benign
R7418:Ehmt1 UTSW 2 24884634 missense probably benign 0.02
R7633:Ehmt1 UTSW 2 24815780 missense possibly damaging 0.68
R7716:Ehmt1 UTSW 2 24884499 missense probably damaging 0.99
X0062:Ehmt1 UTSW 2 24863836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCATAAAGTCTTAAGGGC -3'
(R):5'- TGGCCTTTCAGTAAATGGGAAG -3'

Sequencing Primer
(F):5'- TGCCATAAAGTCTTAAGGGCAGAGG -3'
(R):5'- AAACAGGGATTGATTTTTGGATGC -3'
Posted On2016-06-21