Incidental Mutation 'R5162:Pars2'
ID397041
Institutional Source Beutler Lab
Gene Symbol Pars2
Ensembl Gene ENSMUSG00000043572
Gene Nameprolyl-tRNA synthetase (mitochondrial)(putative)
Synonyms
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106651069-106655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106654538 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 506 (T506A)
Ref Sequence ENSEMBL: ENSMUSP00000102393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058905] [ENSMUST00000106781] [ENSMUST00000106782]
Predicted Effect probably benign
Transcript: ENSMUST00000058905
AA Change: T470A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053160
Gene: ENSMUSG00000043572
AA Change: T470A

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 98 268 4.8e-36 PFAM
Pfam:HGTP_anticodon 371 470 8.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106781
AA Change: T506A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102393
Gene: ENSMUSG00000043572
AA Change: T506A

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 178 391 4.1e-36 PFAM
Pfam:HGTP_anticodon 407 506 3.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106782
SMART Domains Protein: ENSMUSP00000102394
Gene: ENSMUSG00000043572

DomainStartEndE-ValueType
PDB:2I4O|C 63 162 2e-8 PDB
SCOP:d1atia2 95 162 4e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146966
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of proline to tRNA molecules. Mutations have been found in this gene in some patients with Alpers syndrome. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Pars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pars2 APN 4 106654050 missense probably damaging 0.99
IGL03358:Pars2 APN 4 106653042 missense probably benign 0.00
PIT4378001:Pars2 UTSW 4 106654293 missense possibly damaging 0.51
R1384:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R1874:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R1875:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R2041:Pars2 UTSW 4 106653617 missense probably damaging 1.00
R4606:Pars2 UTSW 4 106654050 missense probably benign 0.22
R4790:Pars2 UTSW 4 106651111 utr 5 prime probably benign
R4794:Pars2 UTSW 4 106654210 nonsense probably null
R6066:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R6730:Pars2 UTSW 4 106653431 missense probably damaging 1.00
R6860:Pars2 UTSW 4 106654503 missense probably benign 0.45
R7710:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7712:Pars2 UTSW 4 106654079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACATCATGGAGGCTGTGC -3'
(R):5'- CGGAGTTAATGGCTACATACAAACC -3'

Sequencing Primer
(F):5'- TCCGAGGGGAGGTCCTG -3'
(R):5'- GTTAATGGCTACATACAAACCATCAC -3'
Posted On2016-06-21