Incidental Mutation 'R5162:Cyp3a57'
ID397047
Institutional Source Beutler Lab
Gene Symbol Cyp3a57
Ensembl Gene ENSMUSG00000070419
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 57
SynonymsEG622127
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145345279-145390926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145369083 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 126 (W126R)
Ref Sequence ENSEMBL: ENSMUSP00000133600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079268] [ENSMUST00000174696]
Predicted Effect probably damaging
Transcript: ENSMUST00000079268
AA Change: W126R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078251
Gene: ENSMUSG00000070419
AA Change: W126R

DomainStartEndE-ValueType
Pfam:p450 38 493 6.5e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174696
AA Change: W126R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133600
Gene: ENSMUSG00000070419
AA Change: W126R

DomainStartEndE-ValueType
Pfam:p450 38 147 1.8e-21 PFAM
Meta Mutation Damage Score 0.658 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Cyp3a57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Cyp3a57 APN 5 145371024 missense probably damaging 1.00
IGL00656:Cyp3a57 APN 5 145372549 missense possibly damaging 0.55
IGL01368:Cyp3a57 APN 5 145369068 missense probably damaging 0.99
IGL01602:Cyp3a57 APN 5 145387044 missense probably damaging 1.00
IGL01605:Cyp3a57 APN 5 145387044 missense probably damaging 1.00
IGL01924:Cyp3a57 APN 5 145372629 missense probably benign
IGL02191:Cyp3a57 APN 5 145365685 missense probably damaging 1.00
IGL02213:Cyp3a57 APN 5 145381280 missense probably damaging 1.00
IGL02217:Cyp3a57 APN 5 145369143 splice site probably null
R0141:Cyp3a57 UTSW 5 145362102 missense probably benign 0.05
R0720:Cyp3a57 UTSW 5 145390403 splice site probably benign
R0765:Cyp3a57 UTSW 5 145390410 splice site probably benign
R0976:Cyp3a57 UTSW 5 145390468 missense probably benign 0.01
R1494:Cyp3a57 UTSW 5 145381267 missense probably damaging 0.97
R1624:Cyp3a57 UTSW 5 145390415 critical splice acceptor site probably null
R1732:Cyp3a57 UTSW 5 145365645 missense probably damaging 1.00
R1791:Cyp3a57 UTSW 5 145371010 missense probably benign 0.06
R1839:Cyp3a57 UTSW 5 145381301 missense probably damaging 1.00
R1858:Cyp3a57 UTSW 5 145381249 missense probably damaging 1.00
R2095:Cyp3a57 UTSW 5 145369134 nonsense probably null
R2305:Cyp3a57 UTSW 5 145381280 missense probably damaging 1.00
R3954:Cyp3a57 UTSW 5 145349325 critical splice acceptor site probably null
R4289:Cyp3a57 UTSW 5 145349397 missense probably damaging 1.00
R4463:Cyp3a57 UTSW 5 145381274 missense probably damaging 1.00
R4579:Cyp3a57 UTSW 5 145374264 missense probably benign 0.00
R4598:Cyp3a57 UTSW 5 145390417 missense probably benign 0.01
R4678:Cyp3a57 UTSW 5 145370728 splice site probably null
R4853:Cyp3a57 UTSW 5 145365679 missense probably damaging 1.00
R4954:Cyp3a57 UTSW 5 145370955 critical splice acceptor site probably null
R4977:Cyp3a57 UTSW 5 145349426 splice site probably null
R5226:Cyp3a57 UTSW 5 145365697 missense probably benign 0.04
R5470:Cyp3a57 UTSW 5 145372619 missense probably benign 0.12
R5568:Cyp3a57 UTSW 5 145370646 missense probably benign 0.01
R5652:Cyp3a57 UTSW 5 145349325 critical splice acceptor site probably null
R5872:Cyp3a57 UTSW 5 145371057 nonsense probably null
R6855:Cyp3a57 UTSW 5 145372566 missense probably damaging 0.97
R6861:Cyp3a57 UTSW 5 145370963 missense possibly damaging 0.85
R6893:Cyp3a57 UTSW 5 145386974 nonsense probably null
R7081:Cyp3a57 UTSW 5 145381373 missense probably damaging 1.00
R7305:Cyp3a57 UTSW 5 145370985 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTAAGACCCAGACAATTAACAGTG -3'
(R):5'- TCATCCCAGTAGTGAGGCAATG -3'

Sequencing Primer
(F):5'- ACCCAGACAATTAACAGTGATATTTG -3'
(R):5'- TCCCAGTAGTGAGGCAATGACTTG -3'
Posted On2016-06-21