Incidental Mutation 'R5162:Mpp6'
ID397049
Institutional Source Beutler Lab
Gene Symbol Mpp6
Ensembl Gene ENSMUSG00000038388
Gene Namemembrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)
SynonymsP55t, Pals2
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location50110241-50198939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50178515 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 259 (W259R)
Ref Sequence ENSEMBL: ENSMUSP00000144737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036225] [ENSMUST00000036236] [ENSMUST00000166318] [ENSMUST00000167628] [ENSMUST00000204545]
Predicted Effect probably damaging
Transcript: ENSMUST00000036225
AA Change: W273R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038772
Gene: ENSMUSG00000038388
AA Change: W273R

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 231 296 7.52e-12 SMART
GuKc 350 541 8.92e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000036236
AA Change: W259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039314
Gene: ENSMUSG00000038388
AA Change: W259R

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 217 282 7.52e-12 SMART
GuKc 336 527 8.92e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166318
AA Change: W273R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125880
Gene: ENSMUSG00000038388
AA Change: W273R

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 231 296 7.52e-12 SMART
GuKc 350 541 8.92e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167063
Predicted Effect probably damaging
Transcript: ENSMUST00000167628
AA Change: W273R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129355
Gene: ENSMUSG00000038388
AA Change: W273R

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 231 296 7.52e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204545
AA Change: W259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144737
Gene: ENSMUSG00000038388
AA Change: W259R

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 217 282 7.52e-12 SMART
GuKc 336 527 8.92e-72 SMART
Meta Mutation Damage Score 0.9751 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the peripheral membrane-associated guanylate kinase (MAGUK) family function in tumor suppression and receptor clustering by forming multiprotein complexes containing distinct sets of transmembrane, cytoskeletal, and cytoplasmic signaling proteins. All MAGUKs contain a PDZ-SH3-GUK core and are divided into 4 subfamilies, DLG-like (see DLG1; MIM 601014), ZO1-like (see TJP1; MIM 601009), p55-like (see MPP1; MIM 305360), and LIN2-like (see CASK; MIM 300172), based on their size and the presence of additional domains. MPP6 is a member of the p55-like MAGUK subfamily (Tseng et al., 2001 [PubMed 11311936]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Mpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Mpp6 APN 6 50196589 missense probably benign 0.26
IGL00944:Mpp6 APN 6 50163456 missense possibly damaging 0.96
IGL01576:Mpp6 APN 6 50163492 missense probably benign 0.02
IGL01639:Mpp6 APN 6 50178480 missense probably damaging 0.99
IGL02541:Mpp6 APN 6 50183727 missense probably benign 0.40
IGL02668:Mpp6 APN 6 50194529 missense probably damaging 1.00
R1033:Mpp6 UTSW 6 50183736 missense probably damaging 1.00
R1066:Mpp6 UTSW 6 50145867 missense possibly damaging 0.94
R1542:Mpp6 UTSW 6 50198326 missense probably damaging 1.00
R1799:Mpp6 UTSW 6 50196545 missense probably damaging 0.97
R1817:Mpp6 UTSW 6 50163431 missense probably benign 0.06
R1818:Mpp6 UTSW 6 50163431 missense probably benign 0.06
R4410:Mpp6 UTSW 6 50198268 nonsense probably null
R5591:Mpp6 UTSW 6 50180179 missense probably benign 0.11
R6182:Mpp6 UTSW 6 50198226 missense probably benign
R6500:Mpp6 UTSW 6 50198166 missense possibly damaging 0.67
R6762:Mpp6 UTSW 6 50180438 intron probably null
R6888:Mpp6 UTSW 6 50180277 critical splice donor site probably null
R6963:Mpp6 UTSW 6 50163655 splice site probably null
R7002:Mpp6 UTSW 6 50162662 missense probably benign
R7629:Mpp6 UTSW 6 50196623 missense probably benign 0.07
X0027:Mpp6 UTSW 6 50163531 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CCAGTGCTTAGTGATACACATATAGTC -3'
(R):5'- TAAACCGGGTGACATGCCAC -3'

Sequencing Primer
(F):5'- CACATATAGTCTTTTTCATTGTGCTG -3'
(R):5'- ATGCCTGCTCTTATTTACACAAAC -3'
Posted On2016-06-21