Incidental Mutation 'R5162:Zfp93'
ID397053
Institutional Source Beutler Lab
Gene Symbol Zfp93
Ensembl Gene ENSMUSG00000055305
Gene Namezinc finger protein 93
Synonyms
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24270420-24277794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 24276332 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 581 (Q581E)
Ref Sequence ENSEMBL: ENSMUSP00000104077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032696] [ENSMUST00000108438]
Predicted Effect probably damaging
Transcript: ENSMUST00000032696
AA Change: Q581E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032696
Gene: ENSMUSG00000055305
AA Change: Q581E

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108438
AA Change: Q581E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104077
Gene: ENSMUSG00000055305
AA Change: Q581E

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155851
Meta Mutation Damage Score 0.2220 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Other mutations in Zfp93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Zfp93 APN 7 24275692 missense probably damaging 1.00
IGL02939:Zfp93 APN 7 24275084 missense possibly damaging 0.86
IGL02956:Zfp93 APN 7 24274975 missense probably benign 0.25
FR4342:Zfp93 UTSW 7 24275586 missense possibly damaging 0.92
FR4737:Zfp93 UTSW 7 24275389 small deletion probably benign
R0099:Zfp93 UTSW 7 24275475 missense probably benign 0.01
R0376:Zfp93 UTSW 7 24275861 missense probably damaging 1.00
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1511:Zfp93 UTSW 7 24275731 nonsense probably null
R1628:Zfp93 UTSW 7 24274857 missense probably benign 0.00
R4581:Zfp93 UTSW 7 24275668 missense probably damaging 1.00
R4977:Zfp93 UTSW 7 24275411 missense probably benign 0.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6284:Zfp93 UTSW 7 24275629 nonsense probably null
R6471:Zfp93 UTSW 7 24273329 missense probably damaging 1.00
R6694:Zfp93 UTSW 7 24275913 missense probably damaging 1.00
R6969:Zfp93 UTSW 7 24275381 nonsense probably null
R7543:Zfp93 UTSW 7 24275108 missense probably benign 0.13
R7623:Zfp93 UTSW 7 24276369 missense probably damaging 1.00
R7763:Zfp93 UTSW 7 24275218 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCAGTCATGCCTCCAGTCTG -3'
(R):5'- ACAGCAAATATGGCCGATTTAAGG -3'

Sequencing Primer
(F):5'- AGTCTGCAGGCCCATCACAG -3'
(R):5'- CCCTCTGGTGCATATGGAAATATGAG -3'
Posted On2016-06-21