Incidental Mutation 'R5162:Tsg101'
ID397055
Institutional Source Beutler Lab
Gene Symbol Tsg101
Ensembl Gene ENSMUSG00000014402
Gene Nametumor susceptibility gene 101
SynonymsCC2
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46888949-46919969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46892426 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 260 (T260A)
Ref Sequence ENSEMBL: ENSMUSP00000014546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014546] [ENSMUST00000156335] [ENSMUST00000209538] [ENSMUST00000211076]
Predicted Effect probably damaging
Transcript: ENSMUST00000014546
AA Change: T260A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014546
Gene: ENSMUSG00000014402
AA Change: T260A

DomainStartEndE-ValueType
UBCc 22 177 5.96e-4 SMART
PDB:3IV1|H 229 305 1e-43 PDB
Pfam:Vps23_core 317 380 2.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146130
Predicted Effect probably benign
Transcript: ENSMUST00000156335
SMART Domains Protein: ENSMUSP00000120856
Gene: ENSMUSG00000014402

DomainStartEndE-ValueType
UBCc 51 206 5.96e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209538
AA Change: T122A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211076
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced growth, fail to form mesoderm, accumulate p53 protein and die by embryonic day 6.5. Homozygotes for a mammary gland-specific knockout show impaired mammogenesis and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Tsg101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Tsg101 APN 7 46908925 missense probably damaging 1.00
IGL01505:Tsg101 APN 7 46909060 missense probably damaging 1.00
R1183:Tsg101 UTSW 7 46889624 missense probably benign 0.23
R1558:Tsg101 UTSW 7 46889689 missense probably damaging 1.00
R1560:Tsg101 UTSW 7 46892460 unclassified probably null
R1779:Tsg101 UTSW 7 46907087 missense probably benign 0.00
R2015:Tsg101 UTSW 7 46908904 critical splice donor site probably null
R2329:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R3773:Tsg101 UTSW 7 46889615 makesense probably null
R4108:Tsg101 UTSW 7 46892494 missense probably damaging 1.00
R4618:Tsg101 UTSW 7 46892509 missense possibly damaging 0.76
R5380:Tsg101 UTSW 7 46891120 missense probably damaging 1.00
R5537:Tsg101 UTSW 7 46891128 missense probably benign 0.02
R6939:Tsg101 UTSW 7 46907099 missense probably benign 0.00
R7555:Tsg101 UTSW 7 46913411 missense probably damaging 1.00
R7752:Tsg101 UTSW 7 46913435 missense probably benign 0.01
X0063:Tsg101 UTSW 7 46889631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCACGATGTTTTCAGTGC -3'
(R):5'- AGCCTTCATGTCCAGAGTTTGTG -3'

Sequencing Primer
(F):5'- AACCCACGATGTTTTCAGTGCATTAC -3'
(R):5'- CATGTCCAGAGTTTGTGCATTATC -3'
Posted On2016-06-21