Incidental Mutation 'R5162:Nars2'
ID397056
Institutional Source Beutler Lab
Gene Symbol Nars2
Ensembl Gene ENSMUSG00000018995
Gene Nameasparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Synonyms
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location96951505-97064758 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 97059820 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044466] [ENSMUST00000150681]
Predicted Effect probably benign
Transcript: ENSMUST00000044466
SMART Domains Protein: ENSMUSP00000044937
Gene: ENSMUSG00000018995

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 2.4e-12 PFAM
Pfam:tRNA-synt_2 135 472 1.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122835
Predicted Effect probably benign
Transcript: ENSMUST00000150681
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of asparagine to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 24 (COXPD24). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Nars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Nars2 APN 7 97031579 missense probably benign 0.00
IGL00796:Nars2 APN 7 97031580 missense probably benign 0.40
IGL00990:Nars2 APN 7 97002790 splice site probably benign
IGL02954:Nars2 APN 7 97039893 splice site probably null
IGL03256:Nars2 APN 7 97039910 missense possibly damaging 0.67
IGL03394:Nars2 APN 7 97040013 missense possibly damaging 0.94
R0600:Nars2 UTSW 7 97039923 missense probably damaging 1.00
R0943:Nars2 UTSW 7 96955931 splice site probably benign
R1389:Nars2 UTSW 7 97002829 missense probably benign
R4076:Nars2 UTSW 7 96958094 missense probably damaging 0.99
R4397:Nars2 UTSW 7 96973564 critical splice donor site probably null
R4758:Nars2 UTSW 7 96973528 missense probably damaging 1.00
R4771:Nars2 UTSW 7 97035245 missense probably damaging 1.00
R4908:Nars2 UTSW 7 97023741 missense probably benign 0.07
R6209:Nars2 UTSW 7 97057521 missense probably benign 0.00
R7464:Nars2 UTSW 7 97039930 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCCTGCTGCATTGATTGGCG -3'
(R):5'- ATACTCAGCTCACGTGCCAAG -3'

Sequencing Primer
(F):5'- GGGCACAGGCTTCATTCACTATG -3'
(R):5'- TGGATGACAGCACTATCTACCTC -3'
Posted On2016-06-21