Incidental Mutation 'R5162:Nlrp4g'
ID397064
Institutional Source Beutler Lab
Gene Symbol Nlrp4g
Ensembl Gene ENSMUSG00000079741
Gene NameNLR family, pyrin domain containing 4G
Synonymsnalp4g
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location124348831-124354028 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 124350394 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067621
SMART Domains Protein: ENSMUSP00000065508
Gene: ENSMUSG00000079741

DomainStartEndE-ValueType
Pfam:NACHT 69 238 1.5e-39 PFAM
Blast:LRR 555 582 9e-10 BLAST
Blast:LRR 610 637 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217183
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Nlrp4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Nlrp4g APN 9 124349526 unclassified noncoding transcript
IGL01087:Nlrp4g APN 9 124353858 critical splice acceptor site noncoding transcript
IGL01106:Nlrp4g APN 9 124350452 unclassified noncoding transcript
IGL01938:Nlrp4g APN 9 124349068 unclassified noncoding transcript
IGL02088:Nlrp4g APN 9 124350453 unclassified noncoding transcript
IGL02170:Nlrp4g APN 9 124348980 unclassified noncoding transcript
IGL02582:Nlrp4g APN 9 124349764 unclassified noncoding transcript
IGL02588:Nlrp4g APN 9 124348843 unclassified noncoding transcript
IGL02931:Nlrp4g APN 9 124348940 unclassified noncoding transcript
IGL03111:Nlrp4g APN 9 124353978 exon noncoding transcript
IGL03373:Nlrp4g APN 9 124349853 unclassified noncoding transcript
R0617:Nlrp4g UTSW 9 124349540 unclassified noncoding transcript
R1419:Nlrp4g UTSW 9 124349434 unclassified noncoding transcript
R2060:Nlrp4g UTSW 9 124349693 unclassified noncoding transcript
R2152:Nlrp4g UTSW 9 124353339 exon noncoding transcript
R2356:Nlrp4g UTSW 9 124349306 unclassified noncoding transcript
R2384:Nlrp4g UTSW 9 124349707 unclassified noncoding transcript
R2698:Nlrp4g UTSW 9 124349630 unclassified noncoding transcript
R3878:Nlrp4g UTSW 9 124349362 unclassified noncoding transcript
R4640:Nlrp4g UTSW 9 124349153 unclassified noncoding transcript
R4745:Nlrp4g UTSW 9 124349515 unclassified noncoding transcript
R4754:Nlrp4g UTSW 9 124349788 unclassified noncoding transcript
R4937:Nlrp4g UTSW 9 124354005 exon noncoding transcript
R5024:Nlrp4g UTSW 9 124350155 unclassified noncoding transcript
R5407:Nlrp4g UTSW 9 124349930 unclassified noncoding transcript
R5521:Nlrp4g UTSW 9 124350020 unclassified noncoding transcript
Z1088:Nlrp4g UTSW 9 124349201 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCTTCAAGAACAAATAGATGGCA -3'
(R):5'- GTCAAAACAGGTGAATTTCTTGTTT -3'

Sequencing Primer
(F):5'- ATAGATGGCATGAAATTGTTTTGCTG -3'
(R):5'- AAGTAGGTTCTAGGCTGACCACTC -3'
Posted On2016-06-21