Incidental Mutation 'R5162:Slc38a6'
ID397069
Institutional Source Beutler Lab
Gene Symbol Slc38a6
Ensembl Gene ENSMUSG00000044712
Gene Namesolute carrier family 38, member 6
SynonymsEG625098
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73286779-73354049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73329985 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 138 (S138T)
Ref Sequence ENSEMBL: ENSMUSP00000120810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058139] [ENSMUST00000140523]
Predicted Effect probably benign
Transcript: ENSMUST00000058139
SMART Domains Protein: ENSMUSP00000057153
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134247
Predicted Effect possibly damaging
Transcript: ENSMUST00000140523
AA Change: S138T

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120810
Gene: ENSMUSG00000044712
AA Change: S138T

DomainStartEndE-ValueType
Pfam:Aa_trans 44 452 2.5e-77 PFAM
Meta Mutation Damage Score 0.1941 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Slc38a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Slc38a6 APN 12 73351803 missense probably benign 0.00
IGL01083:Slc38a6 APN 12 73288493 missense possibly damaging 0.94
IGL01302:Slc38a6 APN 12 73288525 critical splice donor site probably null
IGL02106:Slc38a6 APN 12 73350546 missense possibly damaging 0.84
IGL02429:Slc38a6 APN 12 73350568 missense probably benign 0.18
IGL02815:Slc38a6 APN 12 73292205 missense probably damaging 1.00
IGL03001:Slc38a6 APN 12 73337053 missense probably benign 0.03
IGL03167:Slc38a6 APN 12 73350537 nonsense probably null
R0394:Slc38a6 UTSW 12 73352530 missense probably benign
R0918:Slc38a6 UTSW 12 73344785 splice site probably null
R1377:Slc38a6 UTSW 12 73350571 missense probably damaging 0.98
R1533:Slc38a6 UTSW 12 73344852 missense probably benign 0.11
R4171:Slc38a6 UTSW 12 73350552 missense probably benign 0.21
R4579:Slc38a6 UTSW 12 73288524 critical splice donor site probably null
R4864:Slc38a6 UTSW 12 73343650 intron probably null
R5627:Slc38a6 UTSW 12 73343683 missense possibly damaging 0.59
R6189:Slc38a6 UTSW 12 73310196 missense probably damaging 1.00
R6302:Slc38a6 UTSW 12 73337075 missense probably damaging 1.00
R6407:Slc38a6 UTSW 12 73310175 missense probably damaging 1.00
R7289:Slc38a6 UTSW 12 73287012 missense probably benign
R7462:Slc38a6 UTSW 12 73350577 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GCCGATTCTTCTCTACAGAGCC -3'
(R):5'- CCTGAGGCTAAGCACTACATTG -3'

Sequencing Primer
(F):5'- TCTACAGAGCCATTTACCTTGC -3'
(R):5'- CCTCCCTCGACACTAGGTTTTAG -3'
Posted On2016-06-21